Abstract: The present invention relates to a new manufacturing method for phosphonate esters, which have utility as a carbon-carbon binding formation agent, as well as a synthesis intermediate for biologically active substances such as medical drugs and agri-chemicals. Specifically the present invention relates to a new industrially advantageous manufacturing method for phosphonate esters in which the phosphonate esters of the subject can be efficiently obtained with a high yield rate through a simple operation while having barely any side reaction or sub-product. More specifically, the present invention pertains to a manufacturing method for phosphonate esters in which secondary phosphonate esters and alkene compounds are reacted in a transition metal catalyst. In addition the present invention relates to a new manufacturing method for allylphosphonate esters in which secondary cyclic phosphonate esters and 1,3-diene compounds are reacted in a palladium catalyst.

Abstract: The present invention provides a switchable mirror material comprising (1) a magnesium thin film having a thickness of 40 nm or less, or a magnesium-nickel alloy thin film having an alloy composition represented by MgNix (0.1<x<0.3), (2) a transparent catalyst layer formed on a surface of the magnesium-containing thin film, and (3) a transparent protective layer optionally formed on the catalyst layer. The switchable mirror material has a chromic property which allows the thin film to be switched from a mirror state into a transparent state by means of hydrogenation of the thin film at about 20° C., and to be switched from the transparent state into the mirror state by means of dehydrogenation of the thin film in the range of about 20° C. to 100° C.

Abstract: An MIS transistor that uses a silicon carbide substrate has a buried channel structure. The surface orientation of the silicon carbide substrate is optimized so that the device does not assume a normally on state, has good hot-carrier endurance and punch-through endurance, and high channel mobility. In particular, a P-type silicon carbide semiconductor substrate is used to form a buried channel region. To achieve high mobility, the depth at which the buried channel region is formed is optimized, and the ratio between buried channel region junction depth (Lbc) source and drain region junction depth (Xj) is made to be within 0.2 to 1.0. The device can be formed on any surface of a hexagonal or rhombohedral or a (110) surface of a cubic system silicon carbide crystal, and provides a particularly good effect when formed on the (11-20) surface.

Abstract: A diamond semiconductor includes a high-quality thin diamond film layer with few crystal defects and few impurities, implanted with ions of dopant elements and controllable in conductivity determined by a kind and a concentration of the dopant elements. The diamond semiconductor is fabricated by a method including the step of implanting ions of dopant elements into a high-quality thin diamond film layer with few crystal defects and few impurities under conditions that can attain given distribution of concentrations of the dopant elements and with the high-quality thin diamond film layer kept to a temperature in accordance with the conditions so as not to be graphitized, to thereby enable the diamond semiconductor to have conductivity determined by a kind and a concentration of the dopant elements.

Abstract: A heat-storage heater which has a function of compensating a time lag between the generation and emission of heat and comprises a device such as a heat exchanger or electric heater supplying heat to a heat-storing material 1 capable of being supercooled, the heat-storing material 1 being filled into a plurality of small containers 2, a device such as a heat exchanger, thermoelectric element, electrodes, or vibrator 3 for releasing the supercooled state of the heat-storing material, and a thermal radiation surface.

Abstract: A process for the production of a silicon-containing polymer having a main chain of oxygen atoms, organic groups and Si—H and a process for the production of a silicon-containing polymer having a main chain of oxygen atoms, organic groups and disubstituted silicon atoms are disclosed. The silicon-containing polymer may be produced by dehydrogenative polymerization of quinone and/or diol with trihydrosilane or dihydrosilane in the presence of a palladium-containing catalyst.

Abstract: Provided is a downhole percussion drill, which is installed at an end portion of a drillstring and performs drilling by giving impact blows to a drill bit at the bottomhole, which includes a hydraulic hammering mechanism 7 which uses oil having high lubricating ability as a driving medium, a hydraulic pump 8 which pressurizes the oil, and a downhole motor 9 which drives the hydraulic pump 8.

Abstract: A ultra fine particle film forming apparatus is provided which is capable of forming a ultra fine particle film which has ultra fine particles sufficiently bonded together, sufficient density, flat surface and uniform density. A planarized ultra fine particle film forming method for forming a planarized ultra fine particle film from a deposited film of ultra fine particles formed by supplying the ultra fine particles to a substrate, the method comprising one or more of a planarizing step of planarizing a surface of the deposited film of the ultra fine particles supplied to the substrate.

Abstract: A crystallized glass is provided. A &bgr;-quartz solid solution or a &bgr;-eucryptite solid solution is precipitated as a main crystal. The crystallized glass has a crystallization degree not less than 70 mass %, a crystal grain size not more than 0.5 &mgr;m, substantially no gap or crack occurring at boundaries of crystal grains. The crystallized glass also has a thermal expansion coefficient being negatively greater than −10×10−7/° C. within a temperature range of −40° C.˜100° C., a hysteresis of the thermal expansion coefficient within the temperature range being not more than 10 ppm, and a temperature dependence of the refractive index being not more than 13×10−6/° C.

Abstract: A method for producing a lactam by using an organic solvent as a substrate solution, which makes it possible to introduce a high-concentration oxime into flowing high-temperature and high-pressure water, thereby allowing the high-concentration lactam to be synthesized with a high efficiency. With this method, the lactam is continuously synthesized at a high rate from the oxime under high-temperature and high-pressure water mixture conditions within a temperature range of no less than 250° C. and a pressure range of no less than 15 MPa.

Abstract: This invention relates to a method of measuring the internal structure (packing structure or dispersion condition of particulate material) of a composite filled with particles having an irregular matrix by observations based on its optical anisotropy, in which the internal structure (packing structure or dispersion condition of particulate material) of the composite obtained by mixing particulate material as raw material with a liquid material is made visible by utilizing the photoelasticity based on local rearrangement of liquid material molecules or difference of refractive indices of the particulate material and liquid material, and the structure thereof are observed, and an evaluation device using this principle of measurement.

Abstract: To provide an optical fiber strain sensor device and a strain detection method, for measuring precisely AE and for detecting effectively a rapid strain change due to a shock load, an optical fiber strain sensor device includes an FBG sensor mounted on an object to be measured, a broadband light source for directing a broadband wavelength light ray to the FBG sensor, and an FBG filter that reflects or transmits a light ray reflected from the FBG sensor, and, using the FBG filter, the optical fiber strain sensor device processes and detects a change in the center wavelength of the light ray that has been incident from the broadband light source and then has been reflected from the FBG sensor.

Abstract: A surface-type light amplifier device has an active layer of a light amplification section sandwiched between an n-type semiconductor cladding layer that is an n-type semiconductor layer and a p-type semiconductor multilayer reflecting mirror. The light amplification section is attached to a transparent substrate on the side of the n-type semiconductor cladding layer. A plurality of divided electrodes form electrical continuity relative to the p-type semiconductor multilayer reflecting mirror via a p-type cap layer provided on the reflecting mirror. An electrode forming electrical continuity relative to the n-type semiconductor cladding layer is connected to a wiring conductor provided on the surface of the transparent substrate. The device enables amplification of a single, uniform, large diameter beam and oscillation of a laser.

Abstract: A light emitting device includes a silicon substrate (1), a silicon nitride film (2) formed on the surface of the silicon substrate (1), at least an n-type layer (3), (4) and a p-type layer (6), (7) which are formed on the silicon nitride film (2) and also which are made of a ZnO based compound semiconductor, and a semiconductor layer lamination (11) in which layers are laminated to form a light emitting layer. Preferably this silicon nitride film (2) is formed by thermal treatment conducted in an atmosphere containing nitrogen such as an ammonium gas. Also, in another embodiment, a light emitting device is formed by growing a ZnO based compound semiconductor layer on a main face of a sapphire substrate, the main face being perpendicular to the C-face thereof. As a result, it is possible to obtain a device using a ZnO based compound with high properties such as an LED very excellent in crystallinity and having a high light emitting efficiency.

Abstract: A method is provided for adjusting the optical axis of a light transmission path that includes a plurality of optical components. The method uses an apparatus to sequentially adjust the optical axis of one or more of the optical components, using a probabilistic search technique to obtain optimum evaluation value with respect to light transmitted through the light transmission path.

Abstract: An optical recording medium in accordance with the present invention is provided with a substrate, a mask layer, provided on the substrate, whose index of refraction changes due to light or heat of the substrate, and a recording layer that is provided away from the mask layer by a distance that is not more than a distance which allows the near-field light to reach. The mask layer generates a minute opaque region in a light spot and the recording layer is a magneto-optical layer. An optical recording and reproduction apparatus in accordance with the present invention uses the optical recording medium. This allows to provide an optical recording medium and an optical recording and reproduction apparatus that can suppress the erasure of recorded marks and carry out the reproduction again and again.

Abstract: The present invention provides a bioassay system, for detection of hazardous chemical substances, natural toxic substances in the environment and unknown toxic compounds, with high sensitivity, simplicity and speed. The invention provides cells and a method of using the cells for use in the bioassay system. The cell provided by the invention contains a heat shock factor binding DNA sequence and a transcriptional regulatory sequence necessary on an occasion of stress induction as a transcriptional regulatory factor binding site. The cell also possesses a reporter gene under the control of the promoter. The reporter gene is connected, on the downstream side, to the SV40pA signal without any intervening intron.

Abstract: A ribozyme comprising the following base sequence (I) or (II): base sequence (I)(SEQ ID No. 1): 5′-ACCGUUGGUUUCCGUAGUGUAGU GGUUAUCACGUUCGCCUAACACGCGAAAGGUCCCCGGUUCGAAACCGGGCACU ACAAACACAACACUGAUGAGGACCGAAAGGUCCGAAACGGGCACGUCGGAAACG GUUUU[[U]]-3′ base sequence (II)(SEQ ID No. 2): 5′-ACCGUUGGUUUCCGUAGUGUAGUGG UUAUCACGUUCGCCUAACACGCGAAAGGUCCCCGGUUCGAAACCGGGCACUACAAA CCAACACACAACACUGAUGAGGACCGAAAGGUCCGAAACGGGCACGUCGGAAACGG UUUU[[U]]-3′.

Abstract: A main object of the present invention is to provide a novel optical power limiting material of high performance being less susceptible to damages caused by heat occurring when an intensified laser beam is irradiated, having reversible characteristic and exhibiting a stable optical power limiting effect; production of the optical power limiting is simple and economical. The optical power limiting material of the present invention comprises a transparent substrate and an oxide(s) of at least one metal selected from the group consisting of of Ti, V, Cr, Mn, Fe, Co, Ni, Cu, Zn, Nb, Mo, Ru, In, Sn, Sb, Ta, W, Re, Os, Ir and Bi.

Abstract: A fluidized bed reduction reactor (100) for supplying a reduced iron to a melter-gasifier (1) of a smelting reduction system includes an exhaust gas supply unit (3) for supplying an exhaust gas to a reduction gas supply tube (4) interconnecting the melter-gasifier (1) and fluidized bed reduction furnaces (20, 30, 40) when the pressure of the reduction gas in each fluidized bed reduction furnace radically decreases with the occurrence of pressure peak in the melter-gasifier (1). The fluidized bed reduction reactors further include iron ore flow blockage prevention units for directly bypassing some of the reduction gas from each iron ore discharge tube (33, 43) disposed between the neighboring furnaces to the scrubber (50) when the inner pressure of the melter-gasifier (1) radically increases with the occurrence of pressure peak, and a backup gas supply unit supplying a backup nitrogen gas to the bottom of each fluidized bed reduction furnace when a nozzle of a distribution plate (24, 34, 44) is clogged.