Abstract: The invention provides a method of depleting anti-MHC antibodies in a sample comprising contacting said sample with one or more recombinant MHC molecules or functionally equivalent variants, derivatives or fragments thereof and removing at least the recombinant MHC molecules to which antibodies to said recombinant MHC molecules contained within the sample have bound. This method allows the depletion of one or more specific MHC particularly HLA allele antibodies from a sample.

Abstract: Embodiments of the invention provide a simple and robust system that allows non-resonant background to be removed from anti-Stokes signals generated during coherent anti-Stokes Raman spectroscopy (CARS) even when using cheaper laser systems, which do not have transform limited pulses. In particular, resonant CARS signals have a real and imaginary component. The imaginary component is directly related to the spontaneous Raman spectrum, for which there are already large spectral databases to allow chemical identification. The NRB signal, on the other hand, only has a real component. Within embodiments of the invention we recover the imaginary component of the entire CARS signal by simultaneously generating two CARS signals at orthogonal polarisations: one has the imaginary components destructively interfering with (i.e. subtracted from) the real components, the other has them constructively interfering.

Abstract: A method for identifying bacteria in a sample is described which comprises amplifying a portion of the 23S rDNA present in the sample using, as one primer, a degenerate primer set comprising one or more DNA molecules consisting essentially of DNA having the sequence(s) 5?GCGATTTCYGAAYGGGGRAACCC (SEQ ID NO: 1), the other primer consisting of DNA having the sequence 5?TTCGCCTTTCCCTCACGGTACT (SEQ ID NO: 2) and testing the resulting amplicon by hybridization to one or more oligonucleotide probes designed to identify one or more bacteria likely to be present in the sample. The method allows for the identification of at least 8 and considerably more bacterial species in a single test, including Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, Enterococeus spp., Klebsiella spp., Enterobacter spp., Proteus spp., Pneumococci, and coagulase-negative Staphylococci.

Abstract: A calcium/cation-sensing receptor (CaSR) antagonist to treat an inflammatory lung disorder is described. Methods of treatment including the antagonist, combination therapeutics including the antagonist and at least one other agent, and nebulisers or inhalers including the antagonist are also described.

Abstract: A medical imager, primarily for use in oral and dental applications. The imager has a source for providing a plurality of collimated beams of non-ionizing radiation, in particular near-infrared light, and a plurality of correlated detectors. Each detector is arranged to receive unscattered light from one or part of one of said collimated beams and scattered light from one or more other beams. The imager further comprises means for using both the unscattered and scattered light to form an image.

Abstract: The present invention relates to compounds and their use in competitive protein binding assays, for example for use with glycosyl transferase and/or glycoprocessing proteins. The present application also provides kits and apparatuses for use in the assays. In particular, the present invention provides a compound of the formula (I): wherein n is 1, 2 or 3; R1 is selected from —OH, —OPO3H, —OR4, —NHR4, R6; R2 and R3 are each independently selected from —H, —OH, optionally substituted —O-alkyl and —O-alkanoyl; R4 is selected from an optionally substituted mono or polysaccharide, -alkyl, -alkenyl, -alkynyl, and L-Z, where L is a linking agent and Z is a binding agent; R6 is an optionally substituted hydrocarbon group; A is either (i) a substituted heteroaryl group, the substituent on the heteroaryl group having a double bond conjugated to the heteroaryl group, or (ii) a substituted aryl group, the substituent on the aryl group having a double bond conjugated to the aryl group.

Abstract: Methods and products are provided for determining if a subject having a tumor is at risk of metastasis of the tumor. Specifically, the methods comprise detecting phosphorylated cofilin, and both phosphorylated and non-phosphorylated cofilin; quantifying the phosphorylated cofilin, and the total of phosphorylated and nonphosphorylated cofilin; and determining if a subject having the tumor is likely to experience metastasis of the tumor, based on the ratio of the amount of detected phosphorylated cofilin: total amount of phosphorylated and non-phosphorylated cofilin detected. Further disclosed are the types of tumor metastases that can be determined using the methods provided.

Abstract: An assay for identifying an individual having or at risk of developing vascular calcification, said assay comprising obtaining a blood sample from an individual and measuring the level of a vesicular compound in a matrix vesicle present in the blood sample from said individual; wherein an increased level of said compound indicates an individual at risk of developing vascular calcification.

Abstract: A microphone array, comprising N microphones, wherein N is greater than or equal to 3 is provided. The microphones are substantially equiangularly arranged over a circular arc subtending an angle ?, wherein ? is less than or equal to 2?, with the directional axes of the N microphones facing substantially radially outwards. Each of the N microphones have a substantially common directivity function ?(?) defining the directional response of the microphone, wherein ?=0 is the directional axis, and the directivity function ?(?) is arranged such that a sound source in acoustical free field is effectively captured by no more than two consecutive microphones in the array. By arranging the directivity function in this manner crosstalk between non-adjacent microphones can be minimized, which has been shown to improve auditory localization performance.

Abstract: The invention relates to imaging agents, and in particular to multi-modal nanoparticle (NPIA) imaging agents offering magnetic, radionuclide and fluorescent imaging capabilities to exploit the complementary advantages of magnetic resonance imaging (MRI), positron emission tomography (PET), single-photon emission computed tomography (SPECT) and optical imaging (OI). The invention extends to these new types of agents per se, and to uses of such agents in various biomedical applications, such as in therapy and in diagnosis.

Abstract: Methods of screening for candidate compounds capable of inhibiting activity of fyn in phosphorylating tau protein at Y394 or binding to fyn to inhibit interaction with tau protein at Y394, including determining whether, and optionally the extent, the candidate compounds have these capabilities under conditions where fyn has these capabilities in the absence of the candidate compound. Methods of screening for substances capable of promoting dephosphorylation of tau protein by a phosphatase at a site of tau protein including contacting a candidate substance, the tau protein and a phosphatase capable of dephosphorylating the tau protein under conditions where the phosphatase is capable of dephosphorylating the site in absence of the candidate substance, where the kinase is fyn; determining whether, and optionally the extent, the candidate substance promotes dephosphorylation of the tau protein at the site; and selecting the candidate substance which promotes dephosphorylation of the tau protein the sites.

Abstract: The present disclosure provides isolated preproinsulin-derived peptides of 8 or 9 amino acids, comprising the amino acid sequence WGPDPAA (SEQ ID NO: 1), isolated Class I peptide-HLA complexes presenting said peptides and isolated molecules having binding affinity for said peptides and/or said peptide-HLA complexes. Such compositions are useful in the treatment of type 1 diabetes mellitus (T1DM). Such isolated molecules can include a T cell receptor (TCR) having specific binding affinity for a peptide-MHC complex wherein the MHC is an HLA Class I molecule and the peptide is a preproinsulin-derived peptide of 8 to 10 amino acids, comprising the amino acid sequence WGPDPAA (SEQ ID NO: 1).

Abstract: Electronic devices having digital reverberators are disclosed, together with a method of reproducing sound for a user with the digital reverberator. The digital reverberator uses digital surface absorption filters positioned in the reverberator to simulate absorption of energy as digital audio data samples are reflected from virtual surfaces. The position of the digital surface absorption filters enables known frequency-dependent surface absorption characteristics of real materials to be directly implemented using the filter coefficients of each digital surface absorption filter. This enables virtual acoustic spaces to be designed quickly without the need for the digital reverberator to be manually tuned for each space.

Abstract: Embodiments of the present invention provide a continuum manipulator that can be used, for example, as a steerable catheter tip. The manipulator of the embodiments comprises a plurality of segments arranged in a stack, which is then able to bend in a range of directions away from the long axis of the stack. In one embodiment the segments include a helical portion which winds in the direction of the long axis of the stack, and can thus bend away from the long axis in any direction. In another embodiment the segments include a backbone portion with cantilevered rings extending from the backbone portion, separated by bending gaps which allow the segment to bend in a range of directions away from the backbone portion so that the bending gap between the rings closes. In some embodiments a carbon fibre rod is included as a backbone for the stack, to minimise hysteresis and improve repeatability of bending.

Abstract: In one aspect, there is provided an antibody or a functional fragment thereof, wherein the antibody or functional fragment thereof is capable of binding specifically to high molecular weight melanoma associated antigen (HMW-MAA), and binding to an Fc? receptor.

Abstract: A method and apparatus for detecting the presence of the viable cells in an endodontic sample in or taken from an endodontic cavity in the tooth, such as the root canal, enables the rapid and low cost identification of the presence or absence of bacteria or other viable cell tissue in the endodontic space by first incubating a viable cell indicator with an endodontic sample for a pre-determined period suitable for chair-side test and then measuring and/or detecting a change in a parameter (e.g. fluorescence) associated with the viable cell indicator. Thereby, the required level of root canal treatment can be reached which minimizes the risk of re-infection without the time, cost and potentially harm of over-preparation and over treatment by the dental surgeon or of a re-treatment.

Abstract: The invention provides a method of depleting anti-MHC antibodies in a sample comprising contacting said sample with one or more recombinant MHC molecules or functionally equivalent variants, derivatives or fragments thereof and removing at least the recombinant MHC molecules to which antibodies to said recombinant MHC molecules contained within the sample have bound. This method allows the depletion of one or more specific MHC particularly HLA allele antibodies from a sample.

Abstract: The invention identifies and describes proteins that are differentially expressed in platelets resistant to anti-platelet agents such as aspirin (acetylsalicyclic acid) compared to those platelets that are sensitive to such agents. Methods for determining further such differentially expressed proteins and methods for determining an individual's sensitivity to anti-platelet agents, such as aspirin, prior to administration.

Abstract: A method for screening for variant peptides uses mass spectrometry (MS). A system and a kit may be used for performing the method. Proteins in a sample are digested to form a defined series of peptides. The defined series of peptides are ionized. The ionized species are subjected to collision induced dissociation. Species of known mass/charge ratio are detected to confirm the presence of the protein variant in the original sample.

Abstract: The invention provides a method of detecting the presence of anti-MHC antibodies in a sample comprising contacting said sample with one or more recombinant MHC molecules or functionally equivalent variants, derivatives or fragments thereof and detecting the binding or absence of binding of antibodies to said recombinant MHC molecules. This method allows the detection and/or identification of one or more specific MHC particularly HLA allele antibodies.