Abstract: Nanodiamonds having a positive ?-potential of at least 1 mV for use in sequestration of at least one FGF family member in organisms in vivo and in vitro. It has been found that nanodiamonds with a positive ?-potential show an extremely strong and selective binding to FGF family members, thus leading to their usability in the treatment of diseases related to aberrant FGF-FGFR signalling and/or interaction.

Abstract: The invention provides an isolated thermostable polypeptide possessing FGF2 activity and having at least 85% sequence identity to SEQ ID NO: 2 (FGF2 wt) or a functional fragment thereof, and comprising at least one amino acid substitution R31L and the use thereof in the cell biology research, regenerative medicine and related medical applications or cosmetics. Further it discloses a culture medium comprising subjected FGF2 suitable for culturing a human pluripotent stem cells involving both human embryonic stem cells and induced pluripotent stem cells.

Abstract: A new approach to treatment of hematological malignancies. A GAB1 inhibitor for use in a method of treatment of a hematological malignancy is disclosed. The GAB1 inhibitor may be administered alone, or simultaneously or sequentially with a BTK inhibitor to achieve a synergistic effect.

Abstract: The device for treatment of liquids by the help of generation of an electrically powered discharge of low-temperature plasma in liquid environment where is, when the liquid flows, possible to achieve generation of cavitation or super-cavitation which consists of mutually in series connected a pressure regulator and a cavitation tube which is formed by two mutually connected inlet chamber, confusor, working chamber, diffusor and a discharge chamber, where the essence of the invention is that there is in the inlet chamber in its lengthwise axis in direction of liquid flow placed a powered electrode which by its free end reaches into the working chamber and to it is electrically conductive connected a high voltage source whereas the powered electrode is electrically insulated from the body of the cavitation tube and also is in the discharge chamber placed a grounding electrode which is in electric contact with the liquid.

Abstract: Compounds represented by the structural formula (1) R1, R2, R3, R4, R5, R6 are inhibitors of nucleases, and are useful in particular in a method of treatment and/or prevention of proliferative diseases, neurodegenerative diseases, and other genomic instability associated diseases.

Abstract: Novel 4-(1H-imidazol-5-yl)-1H-pyrrolo[2,3-b]pyridine compounds that are useful in the treatment of lymphomas, leukaemias, and solid tumors.

Abstract: Compounds represented by the structural formula (1) where R1, R2, R3, R4, R5, R6 are inhibitors of nucleases, and are useful in particular in a method of treatment and/or prevention of proliferative diseases, neurodegenerative diseases, and other genomic instability associated diseases.

Abstract: Compounds represented by the structural formula (1) where R1, R2, R3, R4, R5, R6 are inhibitors of nucleases, and are useful in particular in a method of treatment and/or prevention of proliferative diseases, neurodegenerative diseases, and other genomic instability associated diseases.

Abstract: Compounds represented by the structural formula (1) R1, R2, R3, R4, R5, R6 are inhibitors of nucleases, and are useful in particular in a method of treatment and/or prevention of proliferative diseases, neurodegenerative diseases, and other genomic instability associated diseases.

Abstract: A new approach to treatment of hematological malignancies. A GAB1 inhibitor for use in a method of treatment of a hematological malignancy is disclosed. The GAB1 inhibitor may be administered alone, or simultaneously or sequentially with a BTK inhibitor to achieve a synergistic effect.

Abstract: A method is disclosed for determining prognosis for a patient suffering from follicular lymphoma, that determines the amount of miR-31 in a biological sample taken from the body of the patient, and assigns the patient to a prognostic group based on the determined amount of miR-31, wherein the prognostic groups and the threshold values for assignment to the prognostic groups are obtained by analyzing the amount of miR-31 in biological samples of patients with known prognosis. In the biological sample taken from the patient, the miR-31 expression may be determined along with the expression of an endogenous control, which is a small nuclear RNA or stably expressed miRNA, and, in case of absolute quantification, the expression of synthetic standards of these miRNAs and endogenous controls of known number of molecules are determined. The method allows the assignment of patients to prognostic groups by determining miR-31 expression.

Abstract: Method of diagnosing and prognosing colorectal cancer using piRNA-hsa-5937, having the sequence TCCCTGGTGGTCTAGTGGTTAGGATTCGGCA (SEQ ID NO. 1), as a biomarker, in combination with at least one miRNA selected from: (SEQ?ID?NO.?3) miR-23a-3p,?having?the?sequence AUCACAUUGCCAGGGAUUUCC, (SEQ?ID?NO.?4) miR-27a-3p,?having?the?sequence UUCACAGUGGCUAAGUUCCGC, (SEQ?ID?NO.?5) miR-142-5p,?having?the?sequence CAUAAAGUAGAAAGCACUACU. The resulting method uses a body fluid as the input, is non-invasive, has a high sensitivity and specificity even in very early stages of the disease, and is cost-effective.

Abstract: Novel 4-(1H-imidazol-5-yl)-1H-pyrrolo[2,3-b]pyridine compounds that are useful in the treatment of lymphomas, leukaemias, and solid tumors.

Abstract: Nanodiamonds having a positive ?-potential of at least 1 mV for use in sequestration of at least one FGF family member in organisms in vivo and in vitro. It has been found that nanodiamonds with a positive ?-potential show an extremely strong and selective binding to FGF family members, thus leading to their usability in the treatment of diseases related to aberrant FGF-FGFR signalling and/or interaction.

Abstract: A method of plasma treatment of an internal and/or external surface of a hollow electrically non-conductive body. The internal surface of the body and/or its external surface acts a layer of electrical plasma of a surface dielectric barrier discharge generated in a volume of gas by alternating or pulse voltage with an amplitude higher than 100 V from a pair of liquid electrodes formed by an internal electrically conductive liquid situated inside the body and by an external electrically conductive liquid situated outside the body. The electrical plasma is generated above the surface of the electrically conductive liquid, where in the volume of the gas forms a layer of electrical plasma forming a ring copying the shape of the surface of the body wherein the electrical resistance between the liquid electrodes is greater than 10 k?. The invention also is a device for carrying out the aforementioned method.

Abstract: The invention provides compounds represented by the structural formula (1): wherein R1, R2, R3 and R4 are as defined in the claims. The compounds are inhibitors of nucleases, and are useful in particular in a method of treatment and/or prevention of proliferative diseases, neurodegenerative diseases, and other genomic instability associated diseases.

Abstract: The invention relates to furo[3,2-b]pyridines substituted at least in position 5 as inhibitors of protein kinases, regulators or modulators, methods of preparation thereof, pharmaceutical compositions containing the compounds, and pharmaceutical use of the compounds and compositions in the treatment of the diseases such as, for example, cancer or neurodegenerative diseases.

Abstract: A method for reducing or removing organic and/or inorganic contamination from a vacuum system of imaging and analytical devices, wherein at least a portion of the area of the inner surface of the vacuum space of the vacuum system is provided with a photocatalytic layer, at least a portion of this photocatalytic layer being cooled to a temperature in the range of 0 K to 280 K, whereby the photocatalytic layer is afterwards at least partially irradiated by electromagnetic radiation, which activates a photocatalytic reaction of the photocatalytic layer with the adsorbed gases of the atmosphere of the inner vacuum space of the vacuum system, where this reaction decomposes the contaminants, reducing their concentration and/or the concentration of water in the inner vacuum space of the vacuum system.

Abstract: The invention provides compounds represented by the structural formula (1): wherein R1, R2, R3 and R4 are as defined in the claims. The compounds are inhibitors of nucleases, and are useful in particular in a method of treatment and/or prevention of proliferative diseases, neurodegenerative diseases, and other genomic instability associated diseases.

Abstract: The invention relates to furo[3,2-b]pyridines substituted at least in position 5 as inhibitors of protein kinases, regulators or modulators, methods of preparation thereof, pharmaceutical compositions containing the compounds, and pharmaceutical use of the compounds and compositions in the treatment of the diseases such as, for example, cancer or neurodegenerative diseases.