Abstract: Method of diagnosing and prognosing colorectal cancer using piRNA-hsa-5937, having the sequence TCCCTGGTGGTCTAGTGGTTAGGATTCGGCA (SEQ ID NO. 1), as a biomarker, in combination with at least one miRNA selected from: (SEQ?ID?NO.?3) miR-23a-3p,?having?the?sequence AUCACAUUGCCAGGGAUUUCC, (SEQ?ID?NO.?4) miR-27a-3p,?having?the?sequence UUCACAGUGGCUAAGUUCCGC, (SEQ?ID?NO.?5) miR-142-5p,?having?the?sequence CAUAAAGUAGAAAGCACUACU. The resulting method uses a body fluid as the input, is non-invasive, has a high sensitivity and specificity even in very early stages of the disease, and is cost-effective.

Abstract: The invention relates to a method for determining the sensitivity of patients suffering from a cancer disease towards targeted biological therapy based on the inhibition of signaling pathways of the members of HER family (e.g., HER-1, HER-2, HER-3 and HER-4) by determining the expression of the biomarker S6 kinase or its post-translationally modified form or of the biomarkers of the activation of S6 kinase or their post-translationally modified forms in the tumor.