Abstract: This invention provides a method for enhancing utrophin protein production in a cell by inhibiting an utrophin microRNA molecule. Moreover, the invention provides that methods for enhancing utrophin protein production in a muscle cell are used for treating a muscular dystrophy and/or other myopathies.

Abstract: The present disclosure relates generally to methods and protocols for the diagnosis, prognosis and stratification of patients with, or at risk of developing, sporadic amyotrophic lateral sclerosis (ALS). In particular, the methods and protocols of the present disclosure are based on determination of the presence and number of cytosine (C) adenine (A) dinucleotide repeats (CA dinucleotides) within the STMN2 gene.

Abstract: An isolated or purified antisense oligonucleotide targeted to a nucleic acid molecule encoding vascular endothelial growth factor A (VEGF-A) pre-mRNA, wherein the antisense oligonucleotide has a nucleobase sequence selected from the list comprising SEQ ID NO: 1 to SEQ ID NO: 22 which has a modified backbone structure and sequences with at least 95% sequence identity to SEQ ID NO: 1-22 which have a modified backbone structure, and wherein the antisense oligonucleotide inhibits the expression of human VEGF-A.

Abstract: An osmotic separation process for the extraction of a solvent from a first solution with low osmotic pressure, in a first compartment to a second solution with higher osmotic pressure in the second compartment. The first solution and the second solution are separated by a semi-permeable membrane.

Abstract: The invention discloses a method of removing dissolved elements from a liquid. The method comprises a first heating step for heating the liquid using a first heat source, a plurality of distillation steps for purifying the liquid heated by the first heating step, each of the plurality of distillation steps comprising at least one evaporation step and at least one condensation step, and a second heating step, using a second heat source to heat a plurality of flashing chambers, each generating a volume of vapor; wherein the vapor from at least one of the plurality of flashing chambers of the second heating step is introduced into at least one of the plurality of distillation steps.

Abstract: The present invention relates to a method of treating a liquid to extract at least one of carbon, sulphur, nitrogen or phosphate from liquids such as waste water. Preferably, the invention is employed to remove nitrogen from waste water. In an alternate for the invention provides a wastewater treatment system.

Abstract: A method of forming a high strength cement in a permeable starting material, the method comprising the step of combining the starting material with effective amounts of (i) a urease producing micro-organism; (ii) urea; and (iii) calcium ions and wherein the effective amount of the urease producing organism provides a urea hydrolysis rate, under standard conditions, of 0.5-50 mM urea hydrolysed.min?1.

Abstract: The invention provides a process for producing a desalinated aqueous liquid. The process comprising passing a de-gassed aqueous liquid (115) through a reverse osmosis membrane (110). The process may additionally comprise the step of degassing an aqueous liquid (105) to produce the degassed aqueous liquid (115).

Abstract: A compound of Formula (A), wherein R1 is C1-C5 alkyl, C3-C6 branched alkyl, C4-C7 cycloalkyl, C8-C12 fused or bridged polycycloalkyl, or heterocyclic ring, where any of the preceding alkyl, cycloalkyl or heterocyclic ring groups may be singly or multiply substituted with X; R2 is H or R1; and X is halo, carbonyl carboxylic acid, carboxylic ester, carboxamide, substituted carboxamide, hydroxy, alkoxy, thioalkyl, sulphoxide, sulphone, sulphonamide, substituted sulphonamide, phenoxy, substituted phenoxy, phenyl, substituted phenyl, amino, substituted amino (including quaternary ammonium salts), N-oxide, imino, 5-7 membered heterocycle, or substituted heterocycle.

Abstract: A method for detecting a repeat element in a target ruminant nucleic acid sequence, the method comprising the steps of: (a) contacting a nucleic acid probe capable of hybridizing with a nucleotide sequence flanking said element; and (b) detecting the complex formed between the probe and the target nucleic acid wherein the repeat elements are formed of repeating nucleotide sequences of at least (3) nucleotides.

Abstract: A host-cell free method for culturing Cryptosporidium comprising the step of introducing Cryptosporidium, at a first lifecycle stage, into a host-cell free medium under conditions which enable the Cryptosporidium to progress to a second lifecycle stage.

Abstract: The invention provides an improved method of propagating Cryptosporidium in cell culture. The methods supports the complete life cycle or Cryptosporidium and produces all known forms of the parasite in addition to two novel forms. Cryptosporidium parasites propagated in vitro can be used to produce a vaccine composition for immunizing animals against Cryptosporidium infection.

Abstract: The invention provides a purified and isolated Cryptosporidium DNA sequence comprising the nucleotide sequence:GATGGTACTGGATAGATAGTGGAAGTCCCGTATCAGTTCGAGATTCTGAAATTA ATTGGACATCAAGTTATAAAGCAAGCTGGTTATTAAGATTCAAATTTCCCTTTGA AAAGTGTGGCTTTTTTGATATTGGAGGGTTAGGAAGAAGGTT plus methods and kits for detecting and/or identifying the presence of Cryptosporidium.

Abstract: Silver is refined or recovered by dissolving the silver in the form of chloride in dimethylsulfoxide in the presence of additional chloride salts, separating any insoluble salts and the precipitating silver chloride by the addition of water or methanol to the solution.