Patents Assigned to NEC Soft, Ltd.
  • Patent number: 7871803
    Abstract: The present invention provides genes encoding novel luciferases having at least the properties of: being capable of using coelenterazine as their luminescent substrates; and being capable of being recombinantly expressed in a mammal cell as a host and produced to be secreted to the outside of the host cell. Specifically, the gene encoding novel luciferases according to the present invention is a DNA molecule comprising a nucleotide sequence encoding any of the full-length amino acid sequences of two types of luciferase proteins, luciferase 1 and luciferase 2, from M. pacifica, and is, for example, a gene encoding the following full-length amino acid sequence of the luciferase 1.
    Type: Grant
    Filed: December 9, 2004
    Date of Patent: January 18, 2011
    Assignee: NEC Soft, Ltd.
    Inventor: Hiromi Takenaka
  • Publication number: 20100266159
    Abstract: A human tracking apparatus and method capable of highly accurately tracking the movement of persons photographed in moving images includes: an image memory 107 that stores an inputted frame image; a human detecting unit 101 that detects persons photographed in the inputted frame image; a candidate registering unit 106 that registers already detected persons as candidates; a similarity index calculating unit 102 that calculates similarity indices indicating the similarity between the persons detected in the inputted frame image and the registered candidates for two or more types of parameters based on the stored frame images in relation to all combinations of the persons and the candidates; a normalizing unit 103 that normalizes the similarity indices; an integrating unit 104 that integrates the normalized indices for each combination of the detected persons and the candidates; and a tracking unit 105 that identifies a person the same as an arbitrary candidate based on the similarity indices.
    Type: Application
    Filed: April 21, 2009
    Publication date: October 21, 2010
    Applicant: NEC Soft, Ltd.
    Inventors: Kazuya UEKI, Yihong Gong, Fengjun Lv
  • Publication number: 20100235155
    Abstract: The present invention is to provide a method for predicting secondary structure of RNA capable of predicting the secondary structure which has been difficult to predict the secondary structure including pseudonot structure, and an apparatus for predicting secondary structure of RNA using the method for predicting.
    Type: Application
    Filed: March 28, 2007
    Publication date: September 16, 2010
    Applicant: NEC SOFT, LTD.
    Inventor: Jou Akitomi
  • Publication number: 20100216650
    Abstract: The object of the present invention is to provide a method of predicting a higher-order structure of a nucleic acid sequence typified by a G quartet structure, and an apparatus and a program that execute the method. The method according to the present invention relates to a method of predicting a nucleic acid higher-order structure that predicts a higher-order structure of a nucleic acid sequence, the method, including the steps of: extracting bases capable of forming a higher-order structure as a higher-order structure candidate from said nucleic acid sequence; extracting bases capable of forming a stem structure as a stem structure candidate from said nucleic acid sequence; and searching an optimal combinatorial structure based on the higher-order structure candidate and the stem structure candidate.
    Type: Application
    Filed: August 8, 2007
    Publication date: August 26, 2010
    Applicant: NEC Soft, Ltd.
    Inventor: Jou Akitomi
  • Publication number: 20100217743
    Abstract: An attribute estimation system and a method in which there are no cases that the estimation accuracy declines in a specific numerical value area, and an age estimation system, a gender estimation system and an age and gender estimation system using this is provided. It is a system to estimate an age of a person photographed in an input image, the system including: a classifier 3 that estimates the age of a person as a discrete quantity based on data of an input image; a classifier 4 that estimates the age of a person as a continuous quantity based on data of an input image; and an integration unit 7 that integrates an estimated result of the classifier 3 and an estimated result of the classifier 4.
    Type: Application
    Filed: September 18, 2008
    Publication date: August 26, 2010
    Applicant: NEC SOFT, LTD.
    Inventor: Kazuya Ueki
  • Publication number: 20100185397
    Abstract: It is intended to provide a method for identifying a nucleotide sequence necessary for expressing an affinity for a target substance in nucleotide sequences of nucleic acid molecules such as aptamers having the affinity for the target substance based on a homology of the respective nucleotide sequences and an evaluation value related to the affinity of the nucleotide sequences, and a method for predicting a secondary structure of a nucleic acid molecule containing the identified nucleotide sequence. The method for identifying a nucleotide sequence necessary for expressing an affinity for a target substance in nucleotide sequences of nucleic acid molecules having such an affinity is characterized by comprising the steps of: extracting a single-strand region from the nucleotide sequences of nucleic acid molecules by excluding nucleotides capable of forming a stem structure; and searching a motif sequence based on an evaluation value of the affinity from the single-strand region.
    Type: Application
    Filed: October 18, 2007
    Publication date: July 22, 2010
    Applicant: NEC SOFT, LTD.
    Inventor: Jou Akitomi
  • Publication number: 20100129870
    Abstract: The present invention is to provide a method for obtaining an oligonucleotide such as RNA aptamer having high binding capacity to a target substance with easy-to-use and high purity. The method for obtaining oligonucleotide according to the present invention is as follows: A method for obtaining oligonucleotide comprising the steps of: performing an electrophoresis of a nucleic acid molecule/target substance complex comprising a nucleic acid molecule and a target substance; recovering said nucleic acid molecule/target substance complex; extracting the nucleic acid molecule from said nucleic acid molecule/target substance complex; gene amplifying said nucleic acid molecule.
    Type: Application
    Filed: July 10, 2007
    Publication date: May 27, 2010
    Applicants: NEC Soft, Ltd., National Institute of Advanced Industrial Science and Technology
    Inventors: Fumiko Nishikawa, Satoshi Nishikawa, Makio Furuichi, Hiroshi Mizuno, Iwao Waga
  • Publication number: 20100043104
    Abstract: The present invention provides a process for generation of a transformed plant capable of emitting fluorescence by introducing a gene encoding a non-plant-derived fluorescent protein into a plant such that the fluorescent protein is recombinantly expressed in the active form of its mature protein in the leaf or petal of the plant, and also provides a transformed garden plant capable of emitting fluorescence that is generated by using the process. For example, cDNA encoding the full-length amino acid sequence of a Chiridius poppei-derived fluorescent protein CpYGFP or its H52F modified protein CpYGFP H52F is inserted into a T-DNA-based expression vector system, which is in turn introduced into the chromosomal DNA of a plant. As a result, the transformed plant thus generated can exhibit fluorescence attributed to these fluorescent proteins and exhibit no substantial difference in the other phenotypes from wild-type one of the plant.
    Type: Application
    Filed: July 25, 2007
    Publication date: February 18, 2010
    Applicant: NEC SOFT, LTD.
    Inventors: Iwao Waga, Hiromi Takenaka, Shu Muto
  • Publication number: 20100036106
    Abstract: The present invention provides a “nucleic acid adaptor molecule” having specific binding affinity to a GST protein portion serving as an N-terminal fusion partner in a fusion protein consisting of the GST protein and a protein of interest. A “nucleic acid adaptor molecule against a GST protein” according to the present invention is an RNA aptamer molecule having any of the following nucleotide sequences I to III: nucleotide sequence I (SEQ ID NO: 1): GGUAGAUACGAUGGAUGGUUGUGUAAAGGUGGUCGUAUCCGCCGA CAUG ACGCGCAGCCAA 61; nucleotide sequence II (SEQ ID NO: 2): GGUAGAUACGAUGGACUAACUGCGCAAAUUACUCGUAUUAGCCGA CAUG ACGCGCAGCCAA 61; or nucleotide sequence III (SEQ ID NO: 3): GGUAGAUACGAUGGAUACCGAAAAAUUAGUGUCGUUGACUGCAA CAUGA CGCGCAGCCAA 60.
    Type: Application
    Filed: March 30, 2005
    Publication date: February 11, 2010
    Applicants: NEC Soft, Ltd., National Institute of Advanced Industrial Science and Technology
    Inventors: Yoshihito Yoshida, Kumar K.R. Penmetca, Satoshi Nishikawa, Iwao Waga
  • Publication number: 20090318673
    Abstract: The present invention provides: a method of changing the fluorescence wavelength of a GFP-like fluorescent protein from copepod while maintaining recombinant expression efficiency, which comprises identifying a structural factor for determining the fluorescence wavelength thereof in the three-dimensional structure of the protein and modifying amino acid residues associated with the structural factor; and a modified fluorescent protein obtained by applying said method. For example, with regard to a GFP-like fluorescent protein from Chiridius poppei, His52 in an ? helix-like secondary structure: PFLLSHCMGYGFYHF (?1 47-61) comprising a fluorescent moiety site GYG is replaced with an aromatic amino acid selected from Phe, Tyr and Trp, so as to cause a red shift of the fluorescent peak wavelength; or it is replaced with Ala, Val, Ile, Leu, Gly, Cys, Met, Ser, Thr, or Asp, Asn, Glu or Gln, so as to cause a blue shift of the fluorescence peak wavelength.
    Type: Application
    Filed: January 25, 2007
    Publication date: December 24, 2009
    Applicant: NEC SOFT, LTD.
    Inventors: Kyoko Suto, Hiromi Takenaka, Yasuhiro Takenaka
  • Publication number: 20090233320
    Abstract: The present invention provides genes encoding novel luciferases having at least the properties of: being capable of using coelenterazine as their luminescent substrates; and being capable of being recombinantly expressed in a mammal cell as a host and produced to be secreted to the outside of the host cell. Specifically, the gene encoding novel luciferases according to the present invention is a DNA molecule comprising a nucleotide sequence encoding any of the full-length amino acid sequences of two types of luciferase proteins, luciferase 1 and luciferase 2, from M. pacifica, and is, for example, a gene encoding the following full-length amino acid sequence of the luciferase 1.
    Type: Application
    Filed: December 9, 2004
    Publication date: September 17, 2009
    Applicant: NEC Soft, Ltd.
    Inventor: Hiromi Takenaka
  • Publication number: 20090164114
    Abstract: The route search system of the present invention receives the provision request of the information about route search from a route search terminal. The information included in the provision request from a route search terminal is acquired, calculation processing of the environmental load value of the relevant vehicle and the environmental load value of other vehicle by which it is generated with movement of a relevant vehicle from the acquired information is carried out using an environmental load calculation unit.
    Type: Application
    Filed: December 22, 2008
    Publication date: June 25, 2009
    Applicants: NEC CORPORATION, NATIONAL UNIVERSITY CORPORATION NAGOYA UNIVERSITY, NEC SOFT, LTD.
    Inventors: Takayuki MORIKAWA, Toshiyuki Yamamoto, Tomio Miwa, Akinori Satou, Enjian Yao, Yasuhiro Sugisaki
  • Publication number: 20090123969
    Abstract: The present invention provides a novel fluorescent protein the wavelength of the maximum of the fluorescence of which exists in a wavelength side longer than 510 nm, and which exhibits yellow fluorescence or yellowish green fluorescence and can be expressed in a heterogeneous cell, and a gene encoding the same, wherein the fluorescent protein has an amino acid sequence as set forth in SEQ ID NO: 1 and it is a fluorescent protein derived from a copepod taxonomically classified to Chiridius Poppei.
    Type: Application
    Filed: September 4, 2008
    Publication date: May 14, 2009
    Applicants: NEC SOFT LTD., NATIONAL INSTITUTE OF AGROBIOCHEMICAL SCIENCE
    Inventors: Frederick I. Tsuji, Hiroshi Mizuno, Kenji Takase, Mitsuru Momma, Zui Fujimoto, Toshiyuki Wako, Yasuhiro Takenaka, Noboru Nakura, Hiromi Takenaka
  • Publication number: 20090036647
    Abstract: The present invention provides a novel Kunitz-type inhibitor protein exhibiting high potency to inhibit serine protease activity of human blood coagulation factor Xa. The Kunitz-type inhibitor protein against human blood coagulation factor Xa according to the present invention is a Kunitz-type inhibitor protein: bitoran D from Bitis arietans venom having the following amino-acid sequence I: (SEQ ID NO:1) SKKRP DFCYL PADDG PCRAF IPSFY YNSTS NECNT FIYGG CYGNA NKFES MDECR KTCVA SA, a Kunitz-type inhibitor protein: bitoran V from Bitis arietans venom having the following amino-acid sequence II: (SEQ ID NO:2) C RQNRP DFCYL PAVEG PCRAY IRSFF YNSTS NECEK FFYGG CYGNA NKFET RDECR KTCVA SA, or a modified protein thereof.
    Type: Application
    Filed: June 6, 2005
    Publication date: February 5, 2009
    Applicants: NEC SOFT, LTD.
    Inventor: Takashi Morita
  • Publication number: 20080294351
    Abstract: An exemplary object of the present invention is to provide method, predictor and predicting program for predicting secondary structure of nucleic acid sequence capable of evaluating not only overall similarity and but also localized similarity of secondary structure of nucleic acid sequence. A method according to an exemplary aspect of the present invention includes the steps of: extracting a structural element of the secondary structure from the secondary structure of the nucleic acid sequence; and evaluating a similarity of each structural element of the nucleic acid sequence as a subject, based on a feature vector of the structural element.
    Type: Application
    Filed: May 21, 2008
    Publication date: November 27, 2008
    Applicant: NEC Soft, Ltd.
    Inventor: Jou AKITOMI
  • Patent number: 7442768
    Abstract: The present invention provides a novel fluorescent protein the wavelength of the maximum of the fluorescence of which exists in a wavelength side longer than 510 nm, and which exhibits yellow fluorescence or yellowish green fluorescence and can be expressed in a heterogeneous cell, and a gene encoding the same, wherein the fluorescent protein has an amino acid sequence as set forth in SEQ ID NO:1and it is a fluorescent protein derived from a copepod taxonomically classified to Chiridius Poppei.
    Type: Grant
    Filed: September 30, 2004
    Date of Patent: October 28, 2008
    Assignees: NEC Soft, Ltd., National Institute of Agrobiochemical Science
    Inventors: Frederick I. Tsuji, Hiroshi Mizuno, Kenji Takase, Mitsuru Momma, Zui Fujimoto, Toshiyuki Wako, Yasuhiro Takenaka, Noboru Nakura, Hiromi Takenaka
  • Publication number: 20070258292
    Abstract: In a data/strobe encoding scheme circuit in which data and a strobe signal are transmitted through different lines, changes respectively in the data and the strobe signal are employed as clock signals for a latching operation, and the data is transmitted to a succeeding-stage circuit operating on a second clock signal. The circuit latches predetermined data by an FF circuit and passes a data pair including a signal indicating that the data has been latched and held therein as well as the latched data to the succeeding-stage circuit, activates, if assertion of a signal indicating reception of the data is received from the succeeding-stage circuit, again the FF circuit which has latched the data and has entered a stop state, and receives new data.
    Type: Application
    Filed: April 3, 2007
    Publication date: November 8, 2007
    Applicants: NEC Soft, Ltd., NEC TOSHIBA Space Systems, Ltd.
    Inventors: Hideki Irisawa, Hiroki Hihara, Shuichi Moriyama
  • Publication number: 20070061620
    Abstract: When key interruption is notified to an application in a embedded system like a portable information terminal, sometimes notification of a key event to CPU is not carried out appropriately. A key controller includes a key table containing key information which specifies key type and operation style valid to execution of application by the CPU and notification information which specifies notification style to the interruption controller for each key. A key control unit of the key controller sets key information and notification information corresponding to the application which the CPU executes, in a register of the key controller and notifies the interruption controller of generation of key interruption corresponding to key operation based on the set information.
    Type: Application
    Filed: September 7, 2006
    Publication date: March 15, 2007
    Applicant: NEC SOFT. LTD.
    Inventor: Masataka Watanabe