Patents Assigned to OliX Pharmaceuticals, Inc.
  • Patent number: 11591600
    Abstract: The present technology relates, in part, to long double-stranded RNA (dsRNA) (e.g., 30 or more base pairs) that inhibits gene expression.
    Type: Grant
    Filed: February 12, 2018
    Date of Patent: February 28, 2023
    Assignee: OliX Pharmaceuticals. Inc.
    Inventor: Dong Ki Lee
  • Patent number: 11118184
    Abstract: The present invention relates to an asymmetric siRNA which inhibits an expression of male pattern hair loss target genes and a use thereof and, more particularly, to an asymmetric siRNA which inhibits an expression of 3-oxo-5-alpha-steroid-4-dehydrogenase 1 (SRD5A1) gene, 3-oxo-5-alpha-steroid-4-dehydrogenase 2 (SRD5A2) gene or androgen receptor (AR) gene, and a composition for prevention or treatment of hair loss comprising the asymmetric siRNA.
    Type: Grant
    Filed: February 21, 2018
    Date of Patent: September 14, 2021
    Assignee: OLIX PHARMACEUTICALS, INC.
    Inventors: Sun Woo Hong, Jihye Hwang
  • Patent number: 11040057
    Abstract: In various aspects and embodiments, the invention provides compounds or agents that potentiate siRNA cellular entry or activity, and provides methods for identifying such compounds or agents. Exemplary agents that act as L-type calcium channel blockers are described herein, and are shown to potentiate gene silencing with cp-asiRNAs.
    Type: Grant
    Filed: June 29, 2017
    Date of Patent: June 22, 2021
    Assignee: OliX Pharmaceuticals, Inc.
    Inventors: Dong Ki Lee, Da Seul Son, Yang Hee Kim
  • Patent number: 10947541
    Abstract: In certain aspects, provided herein are RNA complexes (e.g., asymmetric RNA complexes, such as asiRNAs or cell penetrating asiRNAs) that inhibit IL4R?, TRPA1, and/or F2RL1 expression and are therefore useful for treating atopic dermatitis or asthma.
    Type: Grant
    Filed: July 17, 2019
    Date of Patent: March 16, 2021
    Assignee: OliX Pharmaceuticals, Inc.
    Inventors: Dong-Ki Lee, Sun Woo Hong, Hanna Lee, Dayeon Yu, Ji Eom
  • Patent number: 10883105
    Abstract: The present invention relates to a novel, RNAi-inducing nucleic acid molecule having cell penetrating ability and the use thereof, and more particularly, to a novel, RNAi-inducing double-stranded nucleic acid molecule, which has a replacement of the phosphate backbone of at least one nucleotide with phosphorothioate or phosphorodithioate, and has a lipophilic compound conjugated thereto, and thus has high target gene-silencing efficiency while having the ability to penetrate cells without needing a separate intracellular delivery vehicle, and to a method of silencing a target gene using the nucleic acid molecule. The nucleic acid structure according to the present invention has both cholesterol modification and phosphorothioate modification introduced therein, and thus has high gene silencing efficiency while having the ability to penetrate cells without needing a separate intracellular delivery vehicle.
    Type: Grant
    Filed: September 19, 2018
    Date of Patent: January 5, 2021
    Assignee: OliX Pharmaceuticals, Inc.
    Inventor: Sun Woo Hong
  • Patent number: 10829761
    Abstract: In certain aspects, provided herein are RNA complexes (e.g., asymmetric RNA complexes, such as asiRNAs or cell penetrating asiRNAs) that inhibit CTGF expression and are therefore useful for treating idiopathic pulmonary fibrosis.
    Type: Grant
    Filed: April 10, 2019
    Date of Patent: November 10, 2020
    Assignee: OliX Pharmaceuticals, Inc.
    Inventors: Dong Ki Lee, Sun Woo Hong, Tae Yeon Lee, Sae Lo Oom Lee, Ji Hyun Kim, Yu Ran Na, Young-Dong Kim
  • Patent number: 10829760
    Abstract: The present invention relates to an RNAi-inducing nucleic acid molecule having a new structure and the use thereof, and more particularly to a novel nucleic acid molecule having a structure comprising a first strand, which is 24-121 nt in length and comprises a region complementary to a target nucleic acid, and a second strand which is 13-21 nt in length and has a region that binds complementarily to the region of the first strand, which is complementary to the target nucleic acid, so that the nucleic acid molecule inhibits the expression of a target gene with increased efficiency, and to a method of inhibiting the expression of a target gene using the nucleic acid molecule. The nucleic acid molecule structure of the present invention increases the efficiency with which the nucleic acid molecule inhibits the target gene.
    Type: Grant
    Filed: December 14, 2018
    Date of Patent: November 10, 2020
    Assignee: Olix Pharmaceuticals, Inc.
    Inventor: Dong Ki Lee
  • Patent number: 10590423
    Abstract: In certain aspects, provided herein are RNA complexes that inhibit Myeloid differentiation primary response gene 88 (MyD88) and/or Toll-like receptor 3 (TLR3) and are useful in the treatment of age-related macular degeneration (AMD). In certain aspects, provided herein are pharmaceutical compositions comprising such RNA complexes and methods of using such RNA complexes and pharmaceutical compositions.
    Type: Grant
    Filed: July 23, 2018
    Date of Patent: March 17, 2020
    Assignee: OliX Pharmaceuticals, Inc.
    Inventors: Dong-ki Lee, Sun Woo Hong, Isu Hong, Jihye Hwang
  • Patent number: 10519449
    Abstract: In certain aspects, provided herein are RNA complexes (e.g., asymmetric RNA complexes, such as asiRNAs or cell penetrating asiRNAs) that inhibit ANGPT2 and/or PDGFB expression and are therefore useful for treating angiogenesis-associated diseases, such as cancer, AMD, and DME.
    Type: Grant
    Filed: February 1, 2017
    Date of Patent: December 31, 2019
    Assignee: OliX Pharmaceuticals, Inc.
    Inventors: Dong Ki Lee, Sun Woo Hong, Tae Yeon Lee, Sae-Lo-Oom Lee, Hanna Lee, Dayeon Yu, Ji Eom
  • Patent number: 10512600
    Abstract: In certain aspects, provided herein are RNA complexes (e.g., asymmetric RNA complexes, such as asiRNAs and lasiRNAs) that inhibit tyrosinase expression and are therefore useful for reducing melanin production and for treating pigmentation-related disorders associated with excessive melanin production, such as melasma and age spots.
    Type: Grant
    Filed: August 13, 2018
    Date of Patent: December 24, 2019
    Assignee: OliX Pharmaceuticals, Inc.
    Inventors: Sun Woo Hong, Isu Hong, Ji Hyun Kim
  • Patent number: 10358648
    Abstract: In certain aspects, provided herein are RNA complexes (e.g., asymmetric RNA complexes, such as asiRNAs or cell penetrating asiRNAs) that inhibit IL4R?, TRPA1, and/or F2RL1 expression and are therefore useful for treating atopic dermatitis or asthma.
    Type: Grant
    Filed: February 1, 2017
    Date of Patent: July 23, 2019
    Assignee: OliX Pharmaceuticals, Inc.
    Inventors: Dong Ki Lee, Sun Woo Hong, Hanna Lee, Dayeon Yu, Ji Eom
  • Patent number: 10301628
    Abstract: In certain aspects, provided herein are RNA complexes (e.g., asymmetric RNA complexes, such as asiRNAs or cell penetrating asiRNAs) that inhibit CTGF expression and are therefore useful for treating idiopathic pulmonary fibrosis.
    Type: Grant
    Filed: April 10, 2017
    Date of Patent: May 28, 2019
    Assignee: OliX Pharmaceuticals, Inc.
    Inventors: Dong Ki Lee, Sun Woo Hong, Tae Yeon Lee, Sae-Lo-Oom Lee, Ji Hyun Kim, Yu Ran Na, Young-Dong Kim
  • Patent number: 10125362
    Abstract: Provided herein are RNAi-inducing double-stranded nucleic acid molecules having cell penetrating ability and targeting mRNA encoding a connective tissue growth factor (CTGF). In certain embodiments, the RNAi-inducing double-stranded nucleic acid molecule comprises a first strand of having a sequence of UCUUCCAGUCGGUAAGCCGCGAGGGCAGGCC and comprising 4 to 17 phosphorothioate bonds and at least one 2?-O-Me modified nucleotide, as well as a second strand having a sequence of CUUACCGACUGGAAGA and comprising at least one phosphorothioate bond and at least one 2?-O-Me modified nucleotide and further comprising a cholesterol moiety covalently attached to its 3? end.
    Type: Grant
    Filed: May 21, 2013
    Date of Patent: November 13, 2018
    Assignee: OliX Pharmaceuticals, Inc.
    Inventor: Sun Woo Hong
  • Patent number: 10064801
    Abstract: In certain aspects, provided herein are RNA complexes (e.g., asymmetric RNA complexes, such as asiRNAs and lasiRNAs) that inhibit tyrosinase expression and are therefore useful for reducing melanin production and for treating pigmentation-related disorders associated with excessive melanin production, such as melasma and age spots.
    Type: Grant
    Filed: July 27, 2016
    Date of Patent: September 4, 2018
    Assignee: OliX Pharmaceuticals, Inc.
    Inventors: Sun Woo Hong, Isu Hong, Ji Hyun Kim
  • Patent number: 10059949
    Abstract: In certain aspects, provided herein are RNA complexes that inhibit Myeloid differentiation primary response gene 88 (MyD88) and/or Toll-like receptor 3 (TLR3) and are useful in the treatment of age-related macular degeneration (AMD). In certain aspects, provided herein are pharmaceutical compositions comprising such RNA complexes and methods of using such RNA complexes and pharmaceutical compositions.
    Type: Grant
    Filed: November 15, 2016
    Date of Patent: August 28, 2018
    Assignee: OliX Pharmaceuticals, Inc.
    Inventors: Dong Ki Lee, Sun Woo Hong, Isu Hong, Jihye Hwang