Abstract: A method of determining if a cancer patient is susceptible to survival prolongation if treatment is augmented with a clusterin-inhibiting pharmaceutical is provided. The method involves measurement of various patient data and a systematic approach to the analysis. A computer-aided system is also provided.

Abstract: The present invention provides a method for providing antisense therapy which reduces the expression of clusterin to provide therapeutic benefit in the treatment of cancer, comprising administering an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2?-O-methoxyethyl modifications, has nucleotides 5-17 which are 2?deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19, to a human subject in need of treatment for the cancer, which human subject also receives at least one chemotherapeutic agent, hormone ablation therapy, or radiation therapy, wherein the anti-clusterin oligonucleotide is administered at least 3 times during a 5 to 9 day period, wherein at least 1 of the administrations is at a dose other than 640 mg.

Abstract: The present invention provides a method of treating cancer in a subject afflicted with cancer comprising administering to the subject an anti-clusterin oligonucleotide as a monotherapy to treat the cancer. The present invention also provides compositions for treating cancer in a subject afflicted with cancer, comprising an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1). Additionally, the present invention provides pharmaceutical compositions for treating cancer in a subject afflicted with cancer, the composition comprising an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2?-O-methoxyethyl modifications, has nucleotides 5-17 which are 2?deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19.

Abstract: Reduction of HSP27 expression is in beneficial in the treatment of pleural and pulmonary fibrosis and in particular subpleural fibrosis and IPF. Pharmaceutical compositions for this purpose contain an inhibitor of HSP27 and a pharmaceutically acceptable carrier.

Abstract: Reduction of HSP27 expression is in beneficial in the treatment of pleural and pulmonary fibrosis and in particular subpleural fibrosis and IPF. Pharmaceutical compositions for this purpose contain an inhibitor of HSP27 and a pharmaceutically acceptable carrier.

Abstract: A room temperature stable and minimal aggregate liquid formulation comprises an oligonucleotide comprising Seq ID No. 1: or comprising a variant oligonucleotide in which no more than 3 non-sequential bases are different from Seq. ID NO. 1 and an aqueous carrier comprising a aggregation-preventing compound selected from the group consisting of mono and disaccharides and/or sugar alcohols.

Abstract: A room temperature stable and minimal aggregate liquid formulation comprises an oligonucleotide comprising Seq ID No. 1: or comprising a variant oligonucleotide in which no more than 3 non-sequential bases are different from Seq. ID NO. 1 and an aqueous carrier comprising a aggregation-preventing compound selected from the group consisting of mono and disaccharides and/or sugar alcohols.

Abstract: Reduction of HSP27 expression is in beneficial in the treatment of pleural and pulmonary fibrosis and in particular subpleural fibrosis and IPF. Pharmaceutical compositions for this purpose contain an inhibitor of HSP27 and a pharmaceutically acceptable carrier.

Abstract: A room temperature stable and minimal aggregate liquid formulation comprises an oligonucleotide comprising Seq ID No. 1: or comprising a variant oligonucleotide in which no more than 3 non-sequential bases are different from Seq. ID NO. 1 and an aqueous carrier comprising a aggregation-preventing compound selected from the group consisting of mono and disaccharides and/or sugar alcohols.