Abstract: PVT1 exon 9 is overexpressed in aggressively tumorigenic prostate cancer cell lines and prostate tumor tissues. This exon provides a diagnostic tool for the detection and monitoring of aggressive prostate cancer. Several small interfering ribonucleic acids (siRNAs) are disclosed that are useful for treating prostate cancer.

Abstract: A method for isomerizing a double bond is provided. A substrate is exposed to an isomerase enzyme, wherein the isomerase enzyme comprises a redox-regulated ligand switch and heme b cofactor. A reducing agent changes iron (III) to iron (II). The enzyme isomerizes double bonds in the iron (II) state but not in the iron (III) state. In one embodiment, the enzyme is homologous with 15-cis-?-carotene isomerase (Z-ISO).

Abstract: A display system that produces an image that encodes both machine-readable and human-readable data is described. The image has two underlying patterns that are changed at two different rates. The rapidly changing image encodes the machine-readable data and the slower changing image encodes the human-readable data.

Abstract: A rechargeable battery can include a cathode, an anode current collector, an anode comprising zinc, and an electrolyte in ionic communication with both the cathode and the anode current collector. The electrolyte can include an organic ammonium halide. The organic ammonium halide can include an ammonium bromide in some instances.

Abstract: A novel electrode current collector design that can improve performance and extend cycle life for rechargeable batteries based on metal electrodeposition is disclosed. The novel electrode current collector has a reduced effective surface area that can help to balance efficiencies between battery electrodes and to ensure non-uniform electrodeposition of metal onto the anode current collector during charge. One result is mitigation of internal short circuits that can cause a battery to fail prematurely.

Abstract: An alkaline battery comprises an anode, a cathode, a separator disposed between the anode and the cathode, and an electrolyte in fluid communication with the anode, the cathode, and the separator. The separator comprises at least one ion selective layer that can include at least one of graphene, graphene oxide, reduced graphene oxide, functionalized graphene, or combinations thereof. This can allow the ion selective layer to be configured to selectively block zincate ions.

Abstract: In one embodiment, the invention provides a method of purifying recombinant alpha-galactosidase A. The method includes obtaining a lysate from cells recombinantly expressing alpha-galactosidase A grown in a cell culture medium having non-precipitating phosphate; contacting said lysate with a first chromatography media that binds ?-D-mannopyranosyl or ?-D-glucopyranosyl; eluting alpha-galactosidase A from the first chromatography media to generate a first eluate having alpha-galactosidase A, wherein said eluting includes at least one elution pause between 4 and 16 hours; contacting the first eluate with a second chromatography media that binds galactose binding proteins; and eluting alpha-galactosidase A from said second chromatography media to generate a second eluate containing said recombinant alpha-galactosidase A.

Abstract: A device for generating singlet oxygen is provided. The device has elongated posts extending from a surface, the lateral sides of which have particles with a sensitizer that converts triplet oxygen to single oxygen upon exposure to light. An optical fiber conveys light to the sensitizer and a gas supply tube conveys oxygen to the sensitizer. The device is configured to keep the sensitizer from contacting external fluids, such as saliva.

Abstract: Described herein is a chelator for radiolabels (e.g., 89Zr) for targeted PET imaging that is an alternative to DFO. In certain embodiments, the chelator for 89Zr is the ligand, 3,4,3-(LI-1,2-HOPO) (“HOPO”), which exhibits equal or superior stability compared to DFO in chemical and biological assays across a period of several days in vivo. As shown in FIG. 1, the HOPO is an octadentate chelator that stabilizes chelation of radiolabels (e.g., 89Zr). A bifunctional ligand comprising p-SCN-Bn-HOPO is shown in FIG. 4 and FIG. 5. Such a bifunctional ligand can eliminate (e.g., 89Zr) loss from the chelate in vivo and reduce uptake in bone and non-target tissue. Therefore, the bifunctional HOPO ligand can facilitate safer and improved PET imaging with radiolabeled antibodies.

Abstract: A method of inducing spin polarization in an analyte is provided. The method exposes 14N spin defect centers embedded within 25 nm of a diamond surface to a magnetic field while an analyte is near the surface. The 14N spin defect centers are polarized by treatment with an electromagnetic wave protocol having a visible light pulse (p0); a microwave pulse (mw1), a radio frequency pulse (rf1), a microwave pulse (mw2) and a radio frequency pulse (rf2) resulting in polarization of the nuclear spins of the 14N spin defect centers. Polarized spins in the 14N spin defect centers induce spin polarization in the analyte.

Abstract: Nanocages are formed by etching nancubes. The nanocubes are added to an aqueous system having an amphiphilic lipid dissolved in an organic solvent (e.g. a hydrophobic alcohol) to form reverse micelles. As the water evaporates the micelles shrink as etching of the flat surface of the nanocubes occurs. In this fashion hollow nanocages are produced. In one embodiment, the nanocage is covalently attached to a polymer shell (e.g. a dextran shell).

Abstract: In one aspect, the present disclosure provides methods of treating a bacterial infection using an inhibitor of the nucleotidyltransferase superfamily enzyme. In some embodiments, the compounds have one of the following formulas (I), (II), (III), or (IV) wherein R1, R2, and R3 are as defined herein or a pharmaceutically acceptable salt thereof. The compounds may be used to treat a bacterial infection including an infection of Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter species.

Abstract: A method for detecting intrusion is provided using a combination of two AIS algorithms: Negative Selection Algorithm (NSA) and Dendritic Cell Algorithm (DCA). The method includes the following steps, or some functional subset of these steps: periodic monitoring of a data processing system for anomalous behavior that may indicate the presence of an intruder or an undesirable software; using the NSA for the generation of a population of detectors that are used for detecting anomalies in the monitored system via a matching criterion; using the DCA (which runs in parallel to the NSA) to sample traffic and signals coming in or out of the data processing system; using an aggregation system to combine the individual decisions of the NSA and the DCA to form a single final decision.

Abstract: Technologies are described for methods to fabricate lasers to amplify light. The methods may comprise depositing nanoparticles on a substrate. The length, width, and height of the nanoparticles may be less than 100 nm. The methods may further comprise distributing the nanoparticles on the substrate to produce a film. The nanoparticles in the film may be coupled nanoparticles. The coupled nanoparticles may be in disordered contact with each other within the film. The distribution may be performed such that constructive interference of the light occurs by multiple scattering at the boundaries of the coupled nanoparticles within the film. The methods may comprise exposing the film to a power source.

Abstract: A robotic device for providing vertical mobility has a payload is disposed inside a central compartment and supported by a skid. The skid can move up and down through latch and hook pairs to keep intimate contact with the surface and cross over bumps. The apparatus uses a flexible seal to create a reliable vacuum chamber. The flexible seal comprises a foam ring inside fabric pocket. A plurality of rod and spring strips are configured to apply a downward force to the flexible seal to conform with surface curvatures. The fabric pocket fills in the gaps or seams to maintain a vacuum. The air flows inside a manifold and passes through a filter to avoid debris from damaging the vacuum motor assembly.

Abstract: A genetically modified vertebrate is provided that has an enhanced sense due to an over representation of a predetermined odorant receptor. The vertebrate is genetically modified by introduction of DNA that comprises at least four sequential repeats of a sequence whose primary structure is at least 90% homologous with ACATAACTTTTTAATGAGTCT (SEQ ID NO: 1). The DNA causes a nearby odorant receptor coding sequence to be over represented in a singular gene choice fashion relative to a corresponding vertebrate that lacks the DNA.

Abstract: An injectable carboxymethylcellulose (CMC) and methylcellulose (MC) hydrogel derived from the plant-based polysaccharide, cellulose, is provided which gels in situ and repairs the intervertebral disc in the spinal column or other cartilaginous tissues. One specific application is for replacement of the nucleus pulposus (NP), the central gelatinous region of the intervertebral disc, following injury or degeneration.

Abstract: Improved neuromodulation control of neurological abnormalities associated with effector organs in vertebrate beings using direct current stimulation for modulating spinal cord excitability, having a peripheral-current supplying component for providing direct current peripheral nerve stimulation and a spinal-current supplying component providing direct current for spinal stimulation, and a controller managing such functions.

Abstract: This disclosure relates to compounds containing both an NO-releasing moiety and an H2S-releasing moiety and the use of such compounds in treating inflammatory diseases, including cancers.