Abstract: The present invention provides a “nucleic acid adaptor molecule” having specific binding affinity to a GST protein portion serving as an N-terminal fusion partner in a fusion protein consisting of the GST protein and a protein of interest. A “nucleic acid adaptor molecule against a GST protein” according to the present invention is an RNA aptamer molecule having any of the following nucleotide sequences I to III: nucleotide sequence I (SEQ ID NO: 1): GGUAGAUACGAUGGAUGGUUGUGUAAAGGUGGUCGUAUCCGCCGA CAUG ACGCGCAGCCAA 61; nucleotide sequence II (SEQ ID NO: 2): GGUAGAUACGAUGGACUAACUGCGCAAAUUACUCGUAUUAGCCGA CAUG ACGCGCAGCCAA 61; or nucleotide sequence III (SEQ ID NO: 3): GGUAGAUACGAUGGAUACCGAAAAAUUAGUGUCGUUGACUGCAA CAUGA CGCGCAGCCAA 60.

Abstract: A system and methods for characterizing an inspected object on the basis of attenuation determined from pair-wise illuminated voxels. A beam of penetrating radiation characterized by a propagation direction and an energy distribution is scanned relative to an object, while scatter detectors with collimated fields-of-view detect radiation scattered by each voxel of the inspected object that is intercepted by the incident beam of penetrating radiation. By calculating the attenuation of penetrating radiation between pairs of voxels illuminated sequentially by the incident beam, a tomographic image is obtained characterizing the three-dimensional distribution of attenuation in the object of one or more energies of penetrating radiation, and thus of various material characteristics.

Abstract: A rotary valve adapted for injection of a fluid sample into a flow path. According to the invention one and the same valve can be used to input flow from a system pump, a sample pump and a syringe. A loop could be filled from both the sample pump and the syringe and the loop can be emptied by the system pump whereby for example a column is filled. Furthermore the sample pump can be used to pump directly to the column.

Abstract: The present invention discloses a digital halftoning method. The method comprises steps of: (a1) dividing an original image into non-overlapping blocks; (a2) obtaining a Least-Mean-Square trained (LMS-trained) filter by comparing at least a training image and a halftone result corresponding to the training image (a3) optimizing a class matrix with the LMS-trained filter, which involves the diffused area and the diffused weightings; and (a4) processing the non-overlapping blocks by performing a dot diffusion procedure with the optimized class matrix and the diffused weightings to generate a halftone image corresponding to the original image. A detailed class matrix optimizing method as in the above-mentioned step (a3) is also disclosed.

Abstract: The present invention relates to a method for evaluating a test compound for antithrombotic activity, thrombolytic activity, or a combination thereof. This method can include providing or employing a donor test animal and a recipient test animal. The donor and recipient test animals can have been pretreated with test compound. The donor test animal can be configured to provide oxygenated blood to the recipient test animal through a thrombus inducing system. This method also includes initiating transport of blood from the donor test animal to the recipient test animal through the thrombus inducing system. The method can include interrupting respiration of the recipient test animal and determining the length of time that the recipient test animal survives. In this method, a survival time longer than a predetermined threshold time indicates that the test compound has antithrombotic activity, thrombolytic activity, or a combination thereof.

Abstract: The invention provides low molecular weight compounds, namely tetrahydropyrrolo[3,4-c]pyrazoles, showing a high affinity for the ATP pocket of ABL tyrosine kinase. These compounds are thus ATP-competitive tyrosine kinase inhibitors displaying a significant inhibitory potency also, and in particular, towards BCR-ABL inhibitor-resistant T315I ABL mutants. The compounds of the invention find a useful application in the treatment of BCR-ABL inhibitor-resistant ABL-mediated diseases, such as Imatinib-resistant chronic myelogenous leukemia. Moreover, the invention provides a screening method for the identification of compounds capable of binding the ATP pocket of a kinase protein, in particular of the T315I mutant ABL kinase.

Abstract: Upon detection of radiation by using a (three-dimensional) detector capable of distinguishing a detection position in a depth direction and energy, an energy window for distinguishing between a signal and noise is changed depending on the detection position in the depth direction, thus making it possible to obtain scattering components inside the detector. Alternatively, a weight is given to a detection event depending on the detection position in the depth direction and energy information to obtain scattering components inside the detector. Thereby, scattering components inside the detector can be obtained to increase the sensitivity of the detector. In this case, different detecting elements can be used depending on the detection position in the depth direction.

Abstract: [PROBLEMS] To provide a novel method for the allylation of N-acylhydrazones by which enantioselectively allylated N-acylhydrazines can be efficiently obtained. [MEANS FOR SOLVING PROBLEMS] A method for the production of enantioselectively allylated N-acylhydrazines represented by the general formula [3]: [wherein R0 is an optionally substituted hydrocarbon group, an optionally substituted heterocyclic group, or —COOR1 (wherein R1 is a hydrocarbon group); R2 is acyl; R3 and R4 are each hydrogen, or one of R3 and R4 is hydrogen and the other is a hydrocarbon group; and R5 and R6 are each independently hydrogen or a hydrocarbon group], characterized by reacting an N-acylhydrazone represented by the general formula [1]: [wherein R0 and R2 are as defined above] with an allylating agent such as allyltrichlorosilane or crotyltrichlorosilane in the presence of a chiral phosphine oxide.

Abstract: An auto-injector for rapid delivery of a bolus of injectable medication has a generally flat, sealed housing with small peripheral dimensions, approximating those of a credit card. A syringe, configured to be contained within the flat housing is pre-filled with the medication. The housing contains a mechanism that, when triggered, automatically drives the syringe and needle forwardly to an injection position and then continues to compress the volume of the syringe to effect rapid injection. The forward injection end of the device includes an actuator that also conceals and protects the needle at all times and, prevents post-injection hazards. The flat faces of the device have graphic symbols and other visual indicia relating to the operation and condition of the device. The device enables a simple three-step operation that reduces the risk of improper use.

Abstract: A wearable ballistic impact protection system detects impacts to a body. The system includes multiple sensors for detecting vibration. The sensed vibrations are converted to electrical signals which are filtered. Electronic components are provided to determine whether the filtered signal have frequency and amplitude characteristics of impact that cause injury to a body. Preferably, the sensors are Piezo-electric film sensing elements. Information regarding the extent of the impact and injuries to the body may be transmitted to a remote location so that medics or other personnel may be informed to the extent of injuries to the body so that they may provide medical assistance.

Abstract: An injection-locked frequency divider is provided. The injection-locked frequency divider includes a voltage control oscillator (VCO) and a mixer. The VCO includes a LC resonance tank and a negative-resistance generator for generating a differential oscillation signal including a first and a second oscillation signals. The LC resonance tank adjusts a VCO reactance and resonates for generating the differential oscillation signal. The negative-resistance generator coupled to the LC resonance tank eliminates an equivalent resistance generated by the LC resonance tank and maintains the VCO to continuously oscillate.

Abstract: Transdermal delivery peptides for the treatment of skin diseases and/or facilitation or enhancement of transdermal delivery of pharmaceutically active agents are provided. Compositions comprising the transdermal delivery peptides and methods of therapeutic use, including the improvement of transdermal delivery of drugs or other pharmaceutically active agents, are also disclosed. Nucleic acids, expression vectors, and methods of their use, which encode the transdermal delivery peptides are disclosed. Methods are also provided for in vivo phage display for identifying further peptides with enhanced transdermal delivery capability.

Abstract: The present invention relates to a process for the biocatalyst-mediated enantioselective conversion of enantiomeric mixtures of hydrophobic esters using a biphasic solvent system. More particularly, the present invention relates to the enzyme-mediated enantioselective synthesis of anti-viral compounds, such as 2-hydroxymethyl-5-(5-fluorocytosin-1-yl)-1,3-oxathiolane (FTC) and its analogues, in a non-homogenous reaction system.

Abstract: The present invention concerns double stranded RNA compositions and transgenic plants capable of inhibiting expression of essential genes in parasitic nematodes, and methods associated therewith. Specifically, the invention relates to the use of RNA interference to inhibit expression of a target essential parasitic nematode gene, which is a parasitic nematode pas-5 gene, and relates to the generation of plants that have increased resistance to parasitic nematodes.

Abstract: A document is compared to the documents in a document collection using a hash algorithm and collection statistics to detect if the document is similar to any of the documents in the document collection.

Abstract: A light emitting device includes a first light emitting diode (LED) emitting a first light emission of at least a first wavelength, and a second light emitting diode emitting a second light emission of at least a second wavelength. The second LED is placed in close proximity to the first LED such that after a mixing length from the first and second LEDs, a combination of the first and second lights is perceived as one color in the human vision. In use, the first and second LEDs are alternately driven by a power source in the time domain.

Abstract: The present invention relates to concentricolide and its derivatives, a method for the preparation of the compound and its derivatives, a pharmaceutical composition containing concentricolide and its derivatives, and use of the compound and its derivatives for the treatment and prevention of infection caused by human immunodeficiency virus (HIV).

Abstract: Mutant cholera holotoxins having single or double amino acid substitutions or insertions have reduced toxicity compared to the wild-type cholera holotoxin. The mutant cholera holotoxins are useful as adjuvants in antigenic compositions to enhance the immune response in a vertebrate host to a selected antigen from a pathogenic bacterium, virus, fungus, or parasite, a cancer cell, a tumor cell, an allergen, or a self-molecule.

Abstract: A gain control circuit including a resistor with a first terminal and a second terminal; an operational amplifier with an inverting terminal thereof electrically coupled to said first terminal of said resistor; a non-inverting terminal thereof; and an output terminal thereof; an amplifier circuit for transforming the voltage change of said operational amplifier output into a substantially exponential current change; wherein the output of said amplifier circuit is electrically coupled to said inverting terminal of said operational amplifier. The above described gain control circuit is able to perform wide bandwidth input signal buffering with linearity under low voltage and low power conditions. The circuit also offers low output impedances without the need of additional buffers and hence minimizing circuit size and manufacturing costs.

Abstract: A PNA zip-code chip in which PNA zip-code probes are immobilized on a substrate at high density using an epoxy compound as a linker, and method for fabricating such PNA chip. The use of PNA provides the chip with superior properties to DNA chips, allowing precise diagnosis of congenital diseases or base mutations with much higher sensitivity than is achievable with a DNA chip. The use of the PNA zip-code chip enables diagnosis of gene mutations in a simple manner, using only hybridization reaction, without the difficulties associated with processes in which probes must be immobilized directly on a substrate every time the target gene changes.