Abstract: The present invention is related to a self-assembled nanoparticle containing a gB protein of an EB virus and a preparation method and use thereof. The self-assembled nanoparticle comprises a first polypeptide and a second polypeptide; the first polypeptide comprises the gB protein and a first vector subunit, the second polypeptide comprises a second vector subunit; the first vector subunit is I53-50A1, and the second vector subunit is I53-50B.4PT1. In the self-assembled nanoparticle, the gB protein of the EB virus is displayed on the surface of the nanoparticle for the first time. The particle size of the self-assembled nanoparticle is larger than that of the antigen gB, and the chemical stability of the self-assembled nanoparticle is higher than that of the antigen gB, and the binding capacity with the neutralizing antibody of the self-assembled nanoparticle are higher than that of the antigen gB.

Abstract: A method of using BMP9 in combination with an NK cell and a PD-L1 antibody in preparing a medicament for treating liver cancer is provided. Specifically, BMP9 is loaded on a drug carrier microbubble to give a BMP9-carrying microbubble (MB-BMP9), and administered in combination with a natural killer cell (NK cell) and a programmed death-ligand 1 (PD-L1) antibody for treating hepatocellular carcinoma (HCC). The present invention can significantly enhance the efficacy of existing programmed death-ligand 1 (PD-L1) antibody therapies and significantly inhibit the growth of HCC cell graft tumors with significant efficacy.

Abstract: The invention discloses an application of bacteria in preparation of a synergist for an immune checkpoint inhibitor. The bacteria are active bacteria or inactive whole-cell gut microbiota.

Abstract: The present invention relates to a piRNA-54265 detection kit used for early screening, diagnosis, efficacy monitoring and/or prognostic evaluation of colorectal cancer. The detection kit includes a primers combination, including a primer pair and a probe for specifically detecting piRNA-54265; the primer pair is a piRNA-54265 stem-loop PCR primer pair, or a piRNA-54265 PolyA tailed PCR primer pair; the primer pair includes a forward primer and a reverse primer.

Abstract: The present invention relates to a piRNA-54265 detection kit used for early screening, diagnosis, efficacy monitoring and/or prognostic evaluation of colorectal cancer. The detection kit includes a primers combination, including a primer pair and a probe for specifically detecting piRNA-54265; the primer pair is a piRNA-54265 stem-loop PCR primer pair, or a piRNA-54265 PolyA tailed PCR primer pair; the primer pair includes a forward primer and a reverse primer.

Abstract: The present invention belongs to the field of additive manufacturing technology, and discloses a 4D printing method capable of in-situ regulating functional properties of nickel-titanium (NiTi) alloys and the application thereof. The method comprises the following steps: subjecting NiTi alloy bars to atomization milling to obtain NiTi alloy powder with a particle size of 15-53 ?m, placing the NiTi alloy powder in a discharge plasma assisted ball mill for discharge treatment to promote the activation of powder activity, then adding nano-sized Ni powder with a particle size of 100-800 nm to obtain mixed powder, then continuing the discharge treatment to realize the metallurgical bonding between the NiTi alloy powder and the nano-sized Ni powder to obtain the modified powder, and finally using the additive manufacturing technology to prepare and form the modified powder into a functionalized NiTi alloy.

Abstract: A 4D printing method for a titanium-nickel shape memory alloy, and the titanium-nickel shape memory alloy and application thereof. Pure titanium and pure nickel are mixed and smelted, and titanium-nickel alloy bars are obtained; then alloy powder is prepared by means of a rotating electrode atomization method, the powder is sieved, and titanium-nickel alloy powder having a grain size of 15-53 ?m is obtained; and the obtained titanium-nickel alloy powder is placed in a discharge plasma auxiliary ball mill to be subjected to discharge treatment, the powder is subjected to surface modification, and finally the titanium-nickel shape memory alloy is formed by means of SLM forming. The phase composition of the titanium-nickel shape memory alloy is composed of a B2 austenite phase of a CsCl type structure, a B19? Martensite phase of a monocline structure and a Ti2Ni precipitated phase.

Abstract: The invention discloses a method and a device for identifying pathological pictures, wherein the method comprises: obtaining sample data including a positive sample that is a pathological picture of malignant lesion and a negative sample that is a picture of normal tissue or a pathological picture of benign lesion, with a lesion area marked on the pathological picture of a malignant lesion; dividing the sample data into a training set and a testing set; training a deep neural network model using the training set; testing a trained deep neural network model using the testing set; adjusting parameters of the trained deep neural network model according to a testing result; identifying the pathological picture using the trained deep neural network model. The invention can improve the efficiency and accuracy of pathological picture identification.

Abstract: Provided is a method for purifying total mRNA from total RNA with SLFN13, comprising the following steps of: (1) total RNA extraction; (2) enzyme digestion of tRNA and rRNA in the total RNA by using SLFN13; and (3) after the enzyme digestion is completed, directly heating at 70° C. for 15 min to deactivate the enzyme, to obtain the purified total mRNA.

Abstract: Disclosed are markers for nasopharyngeal carcinoma (NPC) diagnosis and prognostic prediction, and use thereof. The INSL5 level in a plasma sample can be determined by means of ELISA. It was found that the INSL5 plasma level is significantly different between NPC patients and healthy population. The analysis results of a ROC curve show that an area under curve of INSL5 is 0.941, the critical value of the INSL5 level is 2.45 ng/ml, and the sensitivity and specificity thereof are 93.2% and 81.5% respectively. In the healthy cohort, the INSL5 level in EBV-positive plasma is significantly higher than that in EBV-negative plasma. The EBV-negative subjects comprise 34 healthy individuals and 72 NPC patients, and the INSL5 levels are observed to be significantly different between these two cohorts. The results of the ROC curve show that the area under curve of INSL5 is 0.988, the critical value of the INSL5 level is 2.25 ng/ml, and the sensitivity and specificity thereof are 97.2% and 91.2% respectively.

Abstract: The present invention relates to a marker piRNA-54265 and a method in diagnosis, treatment, and prognostic evaluation of colorectal cancer. The marker piRNA-54265 is capable of being used for diagnosing and/or treating colorectal cancer, wherein the marker piRNA-54265 is selected from any of molecules as follows: (1) SEQ ID NO.29: tggaggtgatgaactgtctgagcctgacc; (2) SEQ ID NO.30: UGGAGGUGAUGAACUGUCUGAGCCUGACC; (3) SEQ ID NO.31: GGUCAGGCUCAGACAGUUCAUCACCUCCA; (4) a piR-54265 variant and a piR-54265 derivative modified from the molecule shown in (1), (2) or (3) with a same function; (5) a piR-54265 polynucleotide construct capable of down-regulating an amount of the piR-54265 in vivo after being introduced; and (6) an expression vector containing the polynucleotide construct of (5). The method is used for diagnosing/screening colorectal cancer, evaluating chemosensitivity of a colorectal cancer patient, evaluating a prognosis of a colorectal cancer patient or treating colorectal cancer.

Abstract: A tumor-targeting peptide is disclosed. This tumor-targeting peptide comprises a typical motif with the general formula of: XX(Y/F) (D/E) (D/E) XX. The motif is selectively connected with 1-3 amino acids at the C-terminal and/or N-erminal. X represents any one of the twenty natural amino acids or the D type amino acids. The present invention also discloses that the peptide can not only target tumor vessels and tumor cells but also penetrate them and thus can be applied in tumor diagnosis and therapy.