Abstract: In an aspect, there is provided a method for diagnosing or prognosing a subject with cancer, the method comprising: providing cancer DNA sequencing data from a cancer sample comprising cancer DNA from the subject; comparing the cancer DNA sequencing data with control DNA sequencing data to determine genetic aberrations; determining, from the genetic aberrations, the clonal and subclonal populations present in the sample; constructing a phylogenetic map of the clonal and subclonal populations; assigning to the subject a risk level associated with a better or worse patient outcome or response to therapy; wherein a relatively higher risk level is associated with a higher level of evolution and number of subclonal populations and a relatively lower risk level is associated with a lower level of evolution and number of subclonal populations.

Abstract: The present disclosure relates to a biocompatible, electrically conductive biomaterial capable of carrying the electrical potential of a cardiac impulse. The biomaterial comprises a conductive polymer and a biocompatible component. The conductive polymer comprising an aminomethoxybenzoic acid (AMBA) polymer. The present disclosure also relates to treatments, uses and devices using the biocompatible, electrically conductive biomaterial.

Abstract: There is provided herein, the use of mammalian derived HLA class I molecule for in vitro peptide exchange. For example, there is provided a method of producing an HLA class I molecule complexed to a pre-selected peptide comprising: (a) providing a mammalian derived HLA class I molecule complexed to an existing peptide; (b) incubating, in vitro, the HLA class I molecule complexed to the existing peptide with the pre-selected peptide, wherein the pre-selected peptide is at a concentration sufficient to replace the existing peptide to produce the HLA class I molecule complexed to the pre-selected peptide; and the HLA class I molecule comprises ?1, ?2, ?3 and ?2m domains.

Abstract: There is described herein, a method of capturing cell-free methylated DNA from a sample having less than 100 mg of cell-free DNA, comprising the steps of: subjecting the sample to library preparation to permit subsequent sequencing of the cell-free methylated DNA; adding a first amount of filler DNA to the sample, wherein at least a portion of the filler DNA is methylated; denaturing the sample; and capturing cell-free methylated DNA using a binder selective for methylated polynucleotides.

Abstract: Disclosed are apparatuses and methods for irradiating a perfusate. The apparatus includes a tank which defines a first chamber. A separator is located inside the first chamber. The separator defines a second chamber. The first chamber and the second chamber are concentric and have substantially annular cross sections, each having at least one diameter and a substantially common longitudinal axis. A perfusate is introduced into the first chamber by an inlet. A UV radiation-emitting device is disposed inside the second chamber for providing irradiation to the perfusate. Irradiated perfusate is removed from the tank by an outlet. Other apparatuses and systems are described and methods for inactivating micro organisms by performing EVP and irradiating the perfusate.

Abstract: Methods are disclosed for producing populations of cardiomyocytes from pluripotent stem cells. Populations may be enriched for either atrial or ventricular cardiomyocytes and the resulting ventricular population may be essentially free of pacemaker cells. The method includes incubating pluripotent stem cells in a suitable medium with a BMP component, and an activin component, the amounts of activin may be varied to enrich for either atrial or ventricular cardiomyocytes. The enriched populations, as well as methods of using the same to treat patients in need of cardiac repair are disclosed.

Abstract: Disclosed herein are methods for treating a neurodegenerative disease and/or an optic nerve, brain and/or spinal cord injury using a Ndfip1 fusion polypeptide, a Ndfip1 nucleic acid molecule, a construct or expression cassette comprising the Ndfip1 nucleic acid molecule, and a cell comprising the construct and/or expression the fusion polypeptide.

Abstract: A compound of formula (I): as described herein and methods and uses thereof as for mass tagging a biosensor or biologically active material.

Abstract: Disclosed herein are methods and compositions for treatment, prognosis, and diagnosis of cancer, including prostate cancer. Aspects of the disclosure are directed to methods for a subject having prostate cancer determined to have ZNRF3 genomic loss, reduced ZNRF3 expression, and/or increased ZNRF3 methylation. Also disclosed are methods for analysis of tumor DNA for ZNRF3 copy number status, expression, and/or methylation, as well as compositions and kits useful for such analysis.

Abstract: The present disclosure relates generally to neural progenitor cells and therapeutic uses thereof. More particularly, the present disclosure provides cervical spinal cord-specific neural progenitor cells (cerNPCs), methods of producing cerNPCs, pharmaceutical compositions comprising cerNPCs. and methods of treating neurological diseases or disorders with the cerNPCs.

Abstract: There is described herein a method of detecting the presence of DNA from cancer cells in a subject comprising: providing a sample of cell-free DNA from a subject; subjecting the sample to library preparation to permit subsequent sequencing of the cell-free methylated DNA; adding a first amount of filler DNA to the sample, wherein at least a portion of the filler DNA is methylated, then optionally denaturing the sample; capturing cell-free methylated DNA using a binder selective for methylated polynucleotides; sequencing the captured cell-free methylated DNA; comparing the sequences of the captured cell-free methylated DNA to control cell-free methylated DNAs sequences from healthy and cancerous individuals and from individuals with distinct cancer types and subtypes; identifying the presence of DNA from cancer cells if there is a statistically significant similarity between one or more sequences of the captured cell-free methylated DNA and cell-free methylated DNAs sequences from cancerous individuals.

Abstract: Treatments for therapy of a diabetic symmetrical polyneuropathy a subject in need thereof. The treatments includes administration of compositions comprising: an effective amount of a muscarinic acetylcholine receptor antagonist exemplified by pirenzepine, telenzepine, atropine, or derivatives thereof or salts thereof or analogs thereof or derivatives thereof, and a pharmacologically acceptable carrier. The composition may be injectable or alternatively, may be applied topically or alternatively, may be delivered orally. A suitable topical composition may comprise a lotion, a cream, a gel, or a viscous fluid. The muscarinic acetylcholine receptor antagonist may be a muscarinic acetylcholine receptor antagonist salt or a muscarinic acetylcholine receptor antagonist derivative or a muscarinic acetylcholine receptor antagonist analog.

Abstract: Various embodiments are described herein for a system and a method for assessing a risk of ventricular arrhythmias for a patient. For example, the method may comprise receiving ECG data obtained from the patient; analyzing the ECG data to detect abnormal QRS peaks; determining the risk of ventricular arrhythmias for the patient based on the detected abnormal QRS peaks; and providing an indication of the risk of ventricular arrhythmias for the patient. The system may be configured to perform this method.

Abstract: A method comprising obtaining a substantially cell-free sample of blood plasma or blood serum from a subject with osteoarthritis; and detecting a presence of or measuring a level of novel_miRNA_1 (gucuggcucaggguuggg) (SEQ ID NO: 1), novel_miRNA_2 (ucccuguucgggcgccacu) (SEQ ID NO: 2), novel_miRNA_3 (uguuuagcauccuguagccugc) (SEQ ID NO: 3), and novel_miRNA_4 (uaguggguuaucagaacu) (SEQ ID NO: 4). Also provided are methods where additional miRNAs are detected including novel miRNA 5 (SEQ ID NO: 5), novel miRNA 6 (SEQ ID NO: 6), novel miRNA 7 (SEQ ID NO: 7), novel miRNA 8 (SEQ ID NO: 8), novel miRNA 9 (SEQ ID NO: 9), novel miRNA 10 (SEQ ID NO: 10), novel miRNA 11 (SEQ ID NO: 11), novel miRNA 12 (SEQ ID NO: 12), novel miRNA 13 (SEQ ID NO: 13), hsa-miR-335-3p, hsa-miR-199a-5p, hsa-miR-671-3p, hsa-miR-1260b, hsa-miR-191-3p, hsa-miR-335-5p and/or hsa-miR-543.

Abstract: The present disclosure relates to a method for patient-specific optimization of imaging protocols. According to an embodiment, the present disclosure relates to a method for generating a patient-specific imaging protocol, comprising acquiring scout scan data, the scout scan data including scout scan information and scout scan parameters, generating a simulated image based on the acquired scout scan data, deriving a simulated dose map from the generated simulated image, determining image quality of the generated simulated image by applying machine learning to the generated simulated image, the neural network being trained to generate at least one probabilistic quality representation corresponding to at least one region of the generated simulated image, evaluating the determined image quality relative to a image quality threshold and the derived simulated dose map relative to a dosage threshold, optimizing.

Abstract: Provided herein are methods of producing spNPCs from iPSCs or NPCs, cell populations, compositions comprising cell populations, and uses of spNPCs made using the methods described. The method can comprise: a. obtaining unpatterned NPCs, the unpatterned NPCs expressing neuroectodermal markers including Pax6 and Sox1; b. priming the unpatterned NPCs of step a; and c. patterning the primed unpatterned NPCs to produce spNPCS.

Abstract: Provided herein are methods of producing, compositions comprising and uses of oligodendrogenic neural progenitor cells (o-NPCs), made using a combination of PDGFR agonist and thyroxin or a thyroxin analogue. The method includes; obtaining ventralized neural progenitor cells (NPCs), the ventralized NPCs expressing Sox2, Nkx6-1, decreased level of Pax6 compared to unpatterned NPCs, and elevated expression of HoxA4 compared to unpatterned NPCs; culturing the ventralized NPCs for about 12 to about 16 days (days 26-40 of FIG. 7; days 12 to 27 of FIG. 10) in neural expansion media (NEM) supplemented with i) PDGFR agonist for the about 12 to about 16 days and ii) thyroxine or a thyroxine analogue for the latter about 7 to about 9 days, to produce o-NPC expressing Sox2 and Nkx2.2, decreased level of Pax6 and Nkx6.1 compared to ventralized NPCs and elevated level of HoxA4 and Olig2 compared to ventralized NPCs.

Abstract: A method of capturing a population of T-Cell receptor and/or immunoglobulin sequences with variable regions within a patient sample, the method comprising: extracting and/or preparing DNA fragments from the patient sample; ligating a nucleic acid adapter to the DNA fragments, the nucleic acid adapter suitable for recognition by a pre-selected nucleic acid probe; capturing DNA fragments existing in the patient sample using a collection of nucleic acid hybrid capture probes, wherein each capture probe is designed to hybridize to a known V gene segment and/or a J gene segment within the T cell receptor and/or immunoglobulin genomic loci.

Abstract: Methods and related systems and devices are described for performing various AR medical applications, including a method of guiding augmented reality (AR) intervention. In one aspect, a primary client device: receives model sets, an intervention plan having an intervention field, and session information about a session related to the AR intervention from a server; receives first real-time input data from a first input device; generates metrics by evaluating an execution of the intervention plan by comparing the intervention plan to the first real-time input data; displays real-time graphics, based at least in part on the metrics, spatially over the intervention field; receives real-time status data, from the server, about a replicate client device that joins the session; sends the first real-time input data, the metrics and the evaluation computed from the intervention plan, through the server, to the replicate client device.