Abstract: Systems and methods for determining bacterial load in targets are disclosed. An autofluorescence detection and collection device includes a light source configured to illuminate a target with excitation light causing at least one biomarker in the illuminated target to fluoresce. Bacterial autofluorescence data regarding the target is collected and analyzed to determine bacterial load the target. The autofluorescence data may be analyzed using pixel intensity.

Abstract: A method for characterizing a brain electrical signal comprising forming a temporo-spectral decomposition of the signal to form a plurality of time resolved frequency signal values, associating each instance of the signal value with a predetermined function approximating a neurological signal to form a table of coefficients collectively representative of the brain electrical signal.

Abstract: An adaptor for configuring a mobile communication device for tissue imaging is disclosed. The adaptor includes a housing configured to be removably coupled to a mobile communication device, at least one excitation light source for fluorescent imaging, a white light source for white light imaging, and a power source for powering the adaptor. The excitation light source is configured to emit light in one of ultraviolet, visible, near-infrared, and infrared ranges.

Abstract: The invention relates to modulating the SIRP?-CD47 interaction in order to treat hematological cancer and compounds therefor. In some embodiments, there is provided methods and uses of SIRP? polypeptides, fragments and fusion proteins for treating hematological cancer, preferably human acute myeloid leukemia.

Abstract: Treatments for therapy of a diabetic symmetrical polyneuropathy a subject in need thereof. The treatments includes administration of compositions comprising: an effective amount of a muscarinic acetylcholine receptor antagonist exemplified by pirenzepine, telenzepine, atropine, or derivatives thereof or salts thereof or analogs thereof or derivatives thereof, and a pharmacologically acceptable carrier. The composition may be injectable or alternatively, may be applied topically or alternatively, may be delivered orally. A suitable topical composition may comprise a lotion, a cream, a gel, or a viscous fluid. The muscarinic acetylcholine receptor antagonist may be a muscarinic acetylcholine receptor antagonist salt or a muscarinic acetylcholine receptor antagonist derivative or a muscarinic acetylcholine receptor antagonist analog.

Abstract: Various embodiments are described herein for a system and a method for assessing a risk of ventricular arrhythmias for a patient. For example, the method may comprise receiving ECG data obtained from the patient; analyzing the ECG data to detect abnormal QRS peaks; determining the risk of ventricular arrhythmias for the patient based on the detected abnormal QRS peaks; and providing an indication of the risk of ventricular arrhythmias for the patient. The system may be configured to perform this method.

Abstract: A method comprising obtaining a substantially cell-free sample of blood plasma or blood serum from a subject with osteoarthritis; and detecting a presence of or measuring a level of novel_miRNA_1 (gucuggcucaggguuggg) (SEQ ID NO: 1), novel_miRNA_2 (ucccuguucgggcgccacu) (SEQ ID NO: 2), novel_miRNA_3 (uguuuagcauccuguagccugc) (SEQ ID NO: 3), and novel_miRNA_4 (uaguggguuaucagaacu) (SEQ ID NO: 4). Also provided are methods where additional miRNAs are detected including novel miRNA 5 (SEQ ID NO: 5), novel miRNA 6 (SEQ ID NO: 6), novel miRNA 7 (SEQ ID NO: 7), novel miRNA 8 (SEQ ID NO: 8), novel miRNA 9 (SEQ ID NO: 9), novel miRNA 10 (SEQ ID NO: 10), novel miRNA 11 (SEQ ID NO: 11), novel miRNA 12 (SEQ ID NO: 12), novel miRNA 13 (SEQ ID NO: 13), hsa-miR-335-3p, hsa-miR-199a-5p, hsa-miR-671-3p, hsa-miR-1260b, hsa-miR-191-3p, hsa-miR-335-5p and/or hsa-miR-543.

Abstract: The invention provides antibodies that specifically bind transthyretin (TTR). The antibodies can be used for treating or effecting prophylaxis of diseases or disorders associated with TTR accumulation or accumulation of TTR deposits (e.g., TTR amyloidosis). The antibodies can also be used for diagnosing TTR amyloidosis and inhibiting or reducing aggregation of TTR, among other applications.

Abstract: The present disclosure relates to a method for patient-specific optimization of imaging protocols. According to an embodiment, the present disclosure relates to a method for generating a patient-specific imaging protocol, comprising acquiring scout scan data, the scout scan data including scout scan information and scout scan parameters, generating a simulated image based on the acquired scout scan data, deriving a simulated dose map from the generated simulated image, determining image quality of the generated simulated image by applying machine learning to the generated simulated image, the neural network being trained to generate at least one probabilistic quality representation corresponding to at least one region of the generated simulated image, evaluating the determined image quality relative to a image quality threshold and the derived simulated dose map relative to a dosage threshold, optimizing.

Abstract: The present invention relates to a novel co-crystal of the compound of formula (I): wherein the co-former molecule is bisphosphate hemihydrate, to processes for the preparation of the co-crystal, to pharmaceutical compositions containing the co-crystal, to the use of such a co-crystal in the manufacture of a medicament for use in the treatment of cancer and to methods of treating such diseases in the human or animal body by administering a therapeutically effective amount of such a co-crystal.

Abstract: There is described herein a method of prognosing and/or predicting disease progression and/or in subject with prostate cancer, the method comprising: a) providing a sample containing mitochondrial genetic material from prostate cancer cells; b) sequencing the mitochondrial genetic material with respect to at least 1 patient biomarker selected from CSB1, OHR, ATP8 and HV1 (hypervariable region 1); c) comparing the sequence of said patient biomarkers to control or reference biomarkers to determine mitochondrial single nucleotide variations (mtSNVs); and d) determining the a prostate cancer prognosis; wherein a relatively worse outcome is associated with the presence of mtSNVs in CSB1, OHR, ATP8 and a relatively better outcome is associated with the presence of mtSNVs in HV1.

Abstract: Provided herein are methods of producing spNPCs from iPSCs or NPCs, cell populations, compositions comprising cell populations, and uses of spNPCs made using the methods described. The method can comprise: a. obtaining unpatterned NPCs, the unpatterned NPCs expressing neuroectodermal markers including Pax6 and Sox1; b. priming the unpatterned NPCs of step a; and c. patterning the primed unpatterned NPCs to produce spNPCS.

Abstract: An imaging system, such as a surgical microscope, laparoscope, or endoscope or integrated with these devices, includes an illuminator providing patterned white light and/or fluorescent stimulus light. The system receives and images light hyperspectrally, in embodiments using a hyperspectral imaging array, and/or using narrowband tunable filters for passing filtered received light to an imager. Embodiments may construct a 3-D surface model from stereo images, and will estimate optical properties of the target using images taken in patterned light or using other approximations obtained from white light exposures. Hyperspectral images taken under stimulus light are displayed as fluorescent images, and corrected for optical properties of tissue to provide quantitative maps of fluorophore concentration. Spectral information from hyperspectral images is processed to provide depth of fluorophore below the tissue surface. Quantitative images of fluorescence at depth are also prepared.

Abstract: Provided herein are methods of producing, compositions comprising and uses of oligodendrogenic neural progenitor cells (o-NPCs), made using a combination of PDGFR agonist and thyroxin or a thyroxin analogue. The method includes; obtaining ventralized neural progenitor cells (NPCs), the ventralized NPCs expressing Sox2, Nkx6-1, decreased level of Pax6 compared to unpatterned NPCs, and elevated expression of HoxA4 compared to unpatterned NPCs; culturing the ventralized NPCs for about 12 to about 16 days (days 26-40 of FIG. 7; days 12 to 27 of FIG. 10) in neural expansion media (NEM) supplemented with i) PDGFR agonist for the about 12 to about 16 days and ii) thyroxine or a thyroxine analogue for the latter about 7 to about 9 days, to produce o-NPC expressing Sox2 and Nkx2.2, decreased level of Pax6 and Nkx6.1 compared to ventralized NPCs and elevated level of HoxA4 and Olig2 compared to ventralized NPCs.

Abstract: A system for determining a bacterial load of a target is provided. The system includes an adaptor for configuring a mobile communication device for tissue imaging and a mobile communication device. The adaptor includes a housing configured to be removably coupled to a mobile communication device and, an excitation light source for fluorescent imaging. The excitation light source is configured to emit light in one of ultraviolet, visible, near-infrared, and infrared ranges.

Abstract: There is described herein methods of treating a disease associated with extracellular matrix (ECM) in a patient. In some cases, the methods comprise administering to the patient a therapeutically effective amount of fibroblasts which express CD36.

Abstract: A method for generating chondrocytes and/or cartilage, optionally articular like non-hypertrophic chondrocyte cells and/or cartilage like tissue and/or hypertrophic chondrocyte like cells and/or cartilage like tissue, the method comprising: a. culturing a primitive streak-like mesoderm population, optionally a CD56+, PDGFRalpha+ KDR- primitive streak-like mesoderm population, with a paraxial mesoderm specifying cocktail comprising: i. a FGF agonist; ii. a BMP inhibitor; optionally Noggin, LDN-193189, Dorsomorphin; and iii. optionally one or more of a TGFbeta inhibitor, optionally SB431524; and a Wnt inhibitor, optionally DKK1, IWP2, or XAV939; to specify a paraxial mesoderm population expressing cell surface CD73, CD105 and/or PDGFR-beta; b. generating a chondrocyte precursor population comprising: i. culturing the paraxial mesoderm population expressing CD73, CD105 and/or PDGFR-beta at a high cell density optionally in serum free or serum containing media; ii.

Abstract: A method of capturing a population of T-Cell receptor and/or immunoglobulin sequences with variable regions within a patient sample, the method comprising: extracting and/or preparing DNA fragments from the patient sample; ligating a nucleic acid adapter to the DNA fragments, the nucleic acid adapter suitable for recognition by a pre-selected nucleic acid probe; capturing DNA fragments existing in the patient sample using a collection of nucleic acid hybrid capture probes, wherein each capture probe is designed to hybridize to a known V gene segment and/or a J gene segment within the T cell receptor and/or immunoglobulin genomic loci.

Abstract: Systems and methods for determining bacterial load in targets are disclosed. An autofluorescence detection and collection device includes a light source configured to illuminate a target with excitation light causing at least one biomarker in the illuminated target to fluoresce. Bacterial autofluorescence data regarding the target is collected and analyzed to determine bacterial load the target. The autofluorescence data may be analyzed using pixel intensity.