Patents Assigned to University
  • Patent number: 10513563
    Abstract: The present invention provides compositions useful as prodrugs and methods for making the same. The compositions include a fusion protein having a first delivery domain and a second protein precursor domain linked together via a linker sequence. The delivery domain is a protein capable of facilitating entry to a target cells via the endocytotic pathway, such as transferrin. The protein precursor is a prohormone or a profactor, such as proinsulin. Methods of this invention include the steps of selecting a protein suitable as the delivery domain, constructing a vector to encode the fusion protein, and expressing the fusion protein in a suitable expression host. Also disclosed is a method for targeted-delivery of prodrugs to livers and a method of reducing hepatic glucose production.
    Type: Grant
    Filed: May 21, 2012
    Date of Patent: December 24, 2019
    Assignee: University of Southern California
    Inventors: Wei-Chiang Shen, Yan Wang, Jennica Krankel
  • Patent number: 10513494
    Abstract: Methods of treatment useful in the inducement or maintenance of anesthesia in a subject are provided. The methods comprise administering to a subject in need of anesthesia a compound disclosed herein. Also provided are novel compounds having anesthetic effects, pharmaceutical compositions comprising the compounds, and packaged pharmaceuticals. Computer modeling of the compounds demonstrates favorable interactions with the GABA receptor type A. In addition, the compounds display reversible anesthetic effects in an animal model, with dose-response curves similar to those of known general anesthetics. GABA receptor-mediated effects are also demonstrated in a hippocampal brain slice preparation.
    Type: Grant
    Filed: December 5, 2018
    Date of Patent: December 24, 2019
    Assignees: The Board of Trustees of the Leland Stanford Junior University, The United States Government as represented by the Department Of Veterans Affairs
    Inventors: Edward John Bertaccini, Margaret Frances Davies
  • Patent number: 10514351
    Abstract: The present application relates to sensors and methods for detecting and/or quantifying an oxidant such as free chlorine in a liquid sample such as drinking water. The sensors comprise a first electrode, a second electrode and a composite material between and connecting the first electrode and the second electrode, the composite material comprising a semiconductor and a redox-switchable organic compound associated therewith. The methods comprise exposing the liquid sample to the sensor under conditions to oxide the redox-switchable organic compound and analyzing a resulting change in current.
    Type: Grant
    Filed: August 18, 2015
    Date of Patent: December 24, 2019
    Assignee: MCMASTER UNIVERSITY
    Inventors: Ponnambalam Ravi Selvaganapathy, Peter Kruse, Enamul Hoque, Huan-Hsuan Hsu
  • Patent number: 10513773
    Abstract: A process for depositing an inorganic material on a substrate, the process comprising, providing a substrate having a surface, providing a precursor mixture comprising a metal sulfonate, and delivering the precursor mixture to the surface of the substrate, wherein the surface of the substrate is at a substrate temperature of above 450° C. and is sufficient to effect decomposition of the metal sulfonate. The inorganic material may include a metal or a metal oxide. The preferred metal sulfonate is metal triflate.
    Type: Grant
    Filed: February 10, 2016
    Date of Patent: December 24, 2019
    Assignees: Pilkington Group Limited, University College London
    Inventors: Deborah Raisbeck, Simon James Hurst, Ivan P. Parkin, Claire J. Carmalt, Joe A. Manzi
  • Patent number: 10513561
    Abstract: The present invention provides an anti-Myl9 antibody or a Myl9 binding fragment thereof that binds to Myl9 and may inhibit the interaction between Myl9 and CD69 in humans, as well as a pharmaceutical composition comprising the same. A mouse anti-human/mouse Myl9 monoclonal antibody having binding affinity against Myl9 was obtained, and the sequence for the complementarity determining region (CDR) of said mouse anti-human/mouse Myl9 monoclonal antibody was identified. Accordingly, a humanized antibody comprising the CDR sequence of said mouse anti-human/mouse Myl9 monoclonal antibody in the variable region of heavy and light chains was produced.
    Type: Grant
    Filed: January 11, 2017
    Date of Patent: December 24, 2019
    Assignees: National University Corporation Chiba University, Eisai R&D Management Co., Ltd.
    Inventors: Toshinori Nakayama, Motoko Kimura, Koji Hayashizaki, Toshifumi Hirayama, Jungo Kakuta, Yoshimasa Sakamoto, Ryu Gejima, Daisuke Tokita, Kenzo Muramoto, Toshio Imai
  • Patent number: 10516170
    Abstract: A catalyst obtained by first preparing a cermet material with the general formula ABOx, wherein A is selected from the group consisting of Co, Cu, Ni, Ti, and combinations thereof, wherein B is selected from the group consisting of Mo, W, Ce, and combinations thereof, wherein A and B are different elements, and wherein x is a nonzero number ranging from 3 to 7 and represents the moles of O. Next, the cermet is activated in a reducing atmosphere to yield metal particles dispersed within and/or on the cermet.
    Type: Grant
    Filed: April 17, 2017
    Date of Patent: December 24, 2019
    Assignee: The Curators of the University of Missouri
    Inventor: Fatih Dogan
  • Patent number: 10512691
    Abstract: The present invention relates to nanoparticles. In particular, the present invention provides nanoparticles for clinical (e.g., targeted therapeutic), diagnostic (e.g., imaging), and research applications in the field of cardiology. For example, in some embodiments, the present invention provides a method of treating (e.g., ablating) cardiac tissue, comprising: a) contacting an animal with a nanoparticle comprising a matrix, a toxic (e.g., ablative) agent (e.g., sonosensitizer, chemotherapeutic agent (e.g., doxorubicin or cisplatin), or photosensitizer), and a cardiac targeting moiety; and b) administering an activator of the toxic agent (e.g., light, chemical (e.g., pharmaceutical agent) or ultrasound) to at least a portion of the cardiac tissue (e.g., heart) of the animal to activate the toxic agent.
    Type: Grant
    Filed: April 23, 2013
    Date of Patent: December 24, 2019
    Assignee: THE REGENTS OF THE UNIVERSITY OF MICHIGAN
    Inventors: Jerome Kalifa, Raoul Kopelman, Uma Mahesh R. Avula, Gwangseong Kim, Yong-Eun Koo Lee, Hyung Ki Yoon
  • Patent number: 10513545
    Abstract: The present invention relates to: a fusion polypeptide in which an anti-inflammatory polypeptide and a ferritin monomer fragment are bound; and a pharmaceutical composition for treating inflammatory diseases, containing the same as an active ingredient and, more specifically, to: a fusion polypeptide in which an anti-inflammatory polypeptide is fused to an N-terminus and/or a C-terminus of a ferritin monomer fragment from which a portion of a fourth loop and a fifth helix, of a human derived ferritin monomer, are removed; and a use thereof for treating inflammatory diseases.
    Type: Grant
    Filed: September 2, 2016
    Date of Patent: December 24, 2019
    Assignees: KYUNGPOOK NATIONAL UNIVERSITY INDUSTRY-ACADEMIC COOPERATION FOUNDATION, KOREA INSTITUTE OF SCIENCE AND TECHNOLOGY
    Inventors: Jong-Sup Bae, In-San Kim, Won Hwa Lee, Jun Young Seo, So Youn Kim
  • Patent number: 10512665
    Abstract: Disclosed are compositions and methods for inhibiting viral entry.
    Type: Grant
    Filed: June 2, 2016
    Date of Patent: December 24, 2019
    Assignee: UNIVERSITY OF UTAH RESEARCH FOUNDATION
    Inventors: Michael S. Kay, Brett D. Welch
  • Patent number: 10512402
    Abstract: Materials and methods are disclosed for screening advanced glycation end-products from the mammalian ocular lens proteins to quantify early biomarkers for the diagnosis of diabetes mellitus and related complications.
    Type: Grant
    Filed: April 22, 2016
    Date of Patent: December 24, 2019
    Assignee: Board of Trustees of Northern Illinois University
    Inventors: Elizabeth R. Gaillard, Devi Kalyan Karumanchi
  • Patent number: 10512508
    Abstract: An imagery system includes: a camera having a field of view; a light source including a source of structured light, the light source movable relative to the camera; and at least one processor. The at least one processor is programmed to determine, at least, estimated locations of points on a surface exposed to the structured light according to image data received from the field of view of the camera. The light source may include at least one fiducial marker, and the at least one processor may be programmed to determine the estimated position of the source of structured light according to the at least one fiducial marker in the image data. Also, the camera may be a stereoscopic camera.
    Type: Grant
    Filed: June 15, 2016
    Date of Patent: December 24, 2019
    Assignee: The University of British Columbia
    Inventors: Robert Rohling, Philip Edgcumbe, Christopher Nguan
  • Patent number: 10514485
    Abstract: An apparatus for obtaining energy from a polychromatic energy source that emits radiation in a first and a second wavelength band comprises a reflector or an energy receiver having an aperture therein; and a holographic lens that diffracts and focuses the radiation within the first wavelength band from the energy source through said aperture towards a first energy receiver, and transmits the radiation within the second wavelength band from the energy source to the reflector or energy receiver. If a reflector is used, the reflector reflects the radiation transmitted by the holographic lens towards a second energy receiver.
    Type: Grant
    Filed: November 5, 2013
    Date of Patent: December 24, 2019
    Assignee: Arizona Board of Regents on Behalf of the University of Arizona
    Inventors: Raymond K. Kostuk, Shelby D. Vorndran, Deming Zhang, Juan Manuel Russo, Michael Gordon
  • Patent number: 10512251
    Abstract: The presently disclosed subject matter provides tritriacontene compositions for inducing hygienic behavior in honey bees; mite-infested brood extract compositions for inducing hygienic behavior in honey bees; methods of inducing hygienic behavior in honey bees; methods of selecting one or more honey bee(s) exhibiting hygienic behavior, and methods for assessing the degree of hygienic behavior within a honey bee colony.
    Type: Grant
    Filed: July 5, 2016
    Date of Patent: December 24, 2019
    Assignee: University of North Carolina at Greensboro
    Inventors: Kaira Wagoner, Olav Rueppell
  • Patent number: 10513710
    Abstract: In one aspect, the invention relates to a method of loading exosomes with oligonucleotide cargo, by incubating an oligonucleotide comprising one or more hydrophobic modifications with a population of exosomes for a period of time sufficient to allow loading of the exosomes with the oligonucleotide. Exosomes loaded with hydrophobic ally modified oligonucleotide cargo, and uses thereof, are also provided.
    Type: Grant
    Filed: April 17, 2015
    Date of Patent: December 24, 2019
    Assignee: University of Massachusetts
    Inventors: Anastasia Khvorova, Neil Aronin, Marie Cecile Didiot, Reka Haraszti
  • Patent number: 10513525
    Abstract: Saxitoxin analogue compounds, compositions, pharmaceutical compositions, methods of synthesis of saxitoxin analogues, methods of imaging, methods of treatment, including methods of treating pain, are provided. Saxitoxin (STX), gonyautoxin (GTX), and zetekitoxin, and variant STX compounds bind to sodium channels and are effective to reduce or block flow of sodium ions through such channels. Such channel block affects nerve and muscle action, and may be effective to reduce or block pain sensations, relax muscles, reduce muscle spasm, and reduce wrinkles. STX analogue binding to sodium channels may also be useful to locate, image, or mark sodium channels, and so be useful in studying sodium channels and sodium channel disorders, and in the diagnosis and treatment of patients suffering from sodium channel disorders. In embodiments, the variant STX compounds include conjugates having increased serum half-life as compared to STX when administered to a subject.
    Type: Grant
    Filed: October 26, 2015
    Date of Patent: December 24, 2019
    Assignee: The Board of Trustees of the Leland Stanford Junior University
    Inventors: Justin Du Bois, John Mulcahy, Brian Andresen, David C. Yeomans, Sandip Biswal
  • Patent number: 10515982
    Abstract: A semiconductor device includes a semiconductor column including a first conductive region of first conductivity type, a second conductive region of second conductivity type, an intrinsic region disposed between the first conductive region and the second conductive region, and a barrier region of the first conductivity type disposed between the intrinsic region and the second conductive region. A gate electrode is disposed to cover the intrinsic region, and a gate insulating layer is disposed between the gate electrode and the intrinsic region. The semiconductor device may operate as a switch or a volatile memory according to a gate voltage applied to a gate and a drain voltage applied to a drain.
    Type: Grant
    Filed: January 12, 2018
    Date of Patent: December 24, 2019
    Assignee: Korea University Research and Business Foundation
    Inventors: Sangsig Kim, Kyoungah Cho, Minsuk Kim, Yoonjoong Kim, Sola Woo, Doohyeok Lim
  • Patent number: 10513794
    Abstract: A multilayered cathode for a lithium sulfur battery comprising at least one current collector working electrode having a surface comprising a carbon containing layer, two or more sulfur containing layers wherein at least one of the sulfur layers is located in juxtaposition to and in communication with the carbon containing layer, and at least one outermost layer comprising a positively charged polymer for forming interconnected layers of the sulfur containing layer, the carbon containing layer, and the polymer. Preferably, the cathode has layers that are alternatively arranged of two or more different sulfur containing layers. A lithium sulfur battery is provided and a method of making a multilayered cathode for a lithium sulfur battery is disclosed.
    Type: Grant
    Filed: December 7, 2015
    Date of Patent: December 24, 2019
    Assignee: West Virginia University
    Inventors: Jianhua Yan, Bingyun Li, Xingbo Liu
  • Patent number: 10516111
    Abstract: The present subject matter relates to a formulation comprising an organic solvent, a fullerene, and a conjugated polymer, wherein a solution of the conjugated polymer exhibits a peak optical absorption spectrum red shift of at least 100 nm when the conjugated polymer solution is cooled from 120° C. to room temperature, and wherein the fullerene is not phenyl-C71-butyric-acid-methyl-ester (PC71BM). The present subject matter further relates to the use of a formulation as described above further characterized in that the fullerene is not phenyl-C61-butyric-acid-methyl-ester (PC61BM).
    Type: Grant
    Filed: December 26, 2014
    Date of Patent: December 24, 2019
    Assignee: THE HONG KONG UNIVERSITY OF SCIENCE AND TECHNOLOGY
    Inventor: He Yan
  • Patent number: 10512253
    Abstract: A genetically modified vertebrate is provided that has an enhanced sense due to an over representation of a predetermined odorant receptor. The vertebrate is genetically modified by introduction of DNA that comprises at least four sequential repeats of a sequence whose primary structure is at least 90% homologous with ACATAACTTTTTAATGAGTCT (SEQ ID NO: 1). The DNA causes a nearby odorant receptor coding sequence to be over represented in a singular gene choice fashion relative to a corresponding vertebrate that lacks the DNA.
    Type: Grant
    Filed: August 3, 2016
    Date of Patent: December 24, 2019
    Assignee: Research Foundation of the City University of New York
    Inventors: Paul Feinstein, Charlotte D'Hulst
  • Patent number: 10512416
    Abstract: Disclosed are various embodiments for estimating the flow of blood through a blood vessel in a region of interest. Passage of a bolus of fluid through an imaged blood vessel over a period of time is tracked by a computing device. The computing device fits the tracked passage of the bolus of fluid to a modeled passage of the bolus of fluid. The computing device then estimates a volume of blood flow through the imaged blood vessel based at least in part on a fit of the tracked passage of the bolus of fluid to the modeled passage of the bolus of fluid.
    Type: Grant
    Filed: November 11, 2015
    Date of Patent: December 24, 2019
    Assignee: Oxford University Innovation Limited
    Inventors: Flora A. Kennedy McConnell, Stephen J. Payne, Michael A. Chappell, Thomas W. Okell