Patents Assigned to Westmead Institute of Health Research
  • Detection of human herpes virus 6 (HHV6)
    Publication number: 20040018488
    Abstract: The present invention relates to methods for detecting viral pathogens, particularly human herpes virus 6 (HHV6), preferable using polymerase chain reaction (PCR) techniques. The present invention also relates to primer sequences useful in these methods. In a first aspect, the present invention consists in an isolated nucleic acid molecule complementary to and specific for human herpes virus 6 (HHV6) DNA including a sequence selected from the group consisting of 5′ CTTCTGTTTTACAGGAGT (SEQ ID NO:1). 5′ACAATTGCCATTTCGGGGAAGTAC (SEQ ID N0:2), and functionally equivalent sequences.
    Type: Application
    Filed: July 31, 2003
    Publication date: January 29, 2004
    Applicant: Westmead Institute of Health Research
    Inventors: Vigneswary Mala Ratnamohan, Anthony Lawrence Cunningham
  • Detection of human herpes virus 6 (HHV6)
    Patent number: 6627418
    Abstract: The present invention relates to methods for detecting viral pathogens, particularly human herpes virus S (HHV6), preferably using polymerase chain reaction (PCR) techniques. Primer sequences useful in these methods are also described. In a first aspect, the invention provides an isolated nucleic add molecule complementary to and specific for human herpes virus 6 (HHV6) DNA including a sequence selected from 5′CTTCTGTTTTAAGTCGTACAGGAGT (SEQ ID NO: 1), 5′ACAATTGCCATTTCGGGGAAGTAC (SEQ ID NO: 2), and functionally equivalent sequences. A method for detecting HHV6 in a sample suspected of containing HHV6 is also provided.
    Type: Grant
    Filed: May 15, 2001
    Date of Patent: September 30, 2003
    Assignee: Westmead Institute of Health Research
    Inventors: Vigneswary Mala Ratnamohan, Anthony Lawrence Cunningham