Abstract: Provided are methods and compositions for activating oligonucleotide aptamer-deactivated DNA polymerases, comprising cleaving the aptamer by endonuclease V enzymatic activity to reduce or eliminate binding of the oligonucleotide aptamer to the DNA polymerase, thereby activating DNA synthesis activity of the DNA polymerase in a reaction mixture. Mixtures for use in methods of the invention are also provided. In some aspects, the oligonucleotide aptamer comprises one or more deoxyinosine nucleotides providing for aptamer-specific recognition and cleavage of the aptamer by the endonuclease V enzymatic activity. Exemplary oligonucleotide aptamers, mixtures and methods employing endonuclease V enzymatic activity are provided. The methods can be practiced using kits comprising a DNA polymerase-binding oligonucleotide aptamer and at least one endonuclease V enzymatic activity having oligonucleotide aptamer-specific recognition to provide for specific cleavage of the aptamer by the endonuclease V enzymatic activity.

Abstract: The present invention relates to a nucleic acid molecule simultaneously inhibiting the expression of mTOR gene and STAT3 gene, and an anticancer pharmaceutical composition comprising the same. More specifically, base-paired siRNA or shRNA of the present invention, designed to simultaneously inhibit the expression of cancer-related mTOR gene and STAT3 gene in order to surmount the problem that siRNA or shRNA does not achieve high therapeutic effects due to the target specificity thereof, has the effect of promoting the death of cancer cells. In addition, the nucleic acid has the effect of synergistically enhancing the apoptosis of cancer cells when used in combination with an anticancer agent, finding useful applications as an anticancer composition or anticancer aid against various carcinomas.

Abstract: The invention relates to a double-stranded ribonucleic acid (dsRNA) targeting a Serum Amyloid A (SAA) gene, and methods of using the dsRNA to inhibit expression of SAA

Abstract: Described are devices for treating disease in subjects wherein the devices include a sponge comprising a hydrogel, extracellular vesicles (EVs), and an agent. Methods of using the devices to treat or prevent disease such as esophageal adenocarcinoma are also described.

Abstract: This current invention provides methods and agents for preventing and treating autoimmune and lymphoproliferative disease by targeting pathogenic age-associated B cells as well as methods of detecting these pathogenic age-associated B cells as a method of diagnosing and predicting autoimmune disease and other lymphoproliferative and chronic inflammatory disorders. The current invention also provides targets for drug development and basic research for autoimmune diseases and other lymphoproliferative and chronic inflammatory disorders.

Abstract: The present invention provides novel, stable lipid particles comprising one or more active agents or therapeutic agents, methods of making the lipid particles, and methods of delivering and/or administering the lipid particles. More particularly, the present invention provides stable nucleic acid-lipid particles (SNALP) comprising a nucleic acid (such as one or more interfering RNA), methods of making the SNALP, and methods of delivering and/or administering the SNALP.

Abstract: Currently, the present invention provides a pH-sensitive lipid nanoparticle, comprising: a nanoparticle core composed of a mixture of lipid and/or surfactant, and the surface of the nanoparticle core comprising: a imine-omPEG, the imine is a pH-sensitive linker; and a PEG-peptide, wherein the peptide is selected from the group consisting of a RF peptide, a K peptide, and a H peptide; wherein the RF peptide is a potent CPP, the K peptide is a mitochondria-targeting peptide and the H peptide is a cancer specific binding peptide; a lipid, inside the nanoparticle core; wherein the lipid nanoparticle encapsulating a targeting agent.

Abstract: THE present application relates to a method of detecting one or more analytes in a sample, the method comprising (a) providing a carrier nucleic acid molecule with at least one single-stranded region; (b) providing one or more aptamers specific for the analyte, wherein the aptamers additionally comprise a single-stranded portion complementary to at least one single-stranded region on the carrier nucleic acid; (c) contacting the carrier nucleic acid and one or more aptamers with the sample, forming a carrier nucleic acid/N aptamer/analyte complex, and; (d) detecting the presence of the carrier nucleic acid/aptamer/analyte complex.

Abstract: Expression of micoRNAs that negatively regulate the activity of the SNHG14 gene for can be used in treatment of Angelman Syndrome. Such microRNAs include, for example, MIR-92a and/or MIR-145, as well as analogues and variants thereof, for use in treatment of Angelman Syndrome. Expression vectors such as, for example, AAV vectors may be used to transduce cells for introduction of MIR-92a and/or MIR-145 into target tissues for treatment of Angelman Syndrome.

Abstract: The invention provides novel and versatile classes of riboregulators, including inter alia activating and repressing riboregulators, switches, and trigger and sink RNA, and methods of their use for detecting RNAs in a sample such as a well and in modulating protein synthesis and expression.

Abstract: This invention provides a methods and compositions for controlling an insect pest. The methods comprise contacting the insect pest with a composition comprising a yeast cell comprising a nucleic acid encoding a dsRNA molecule which specifically inhibits expression of a target gene in the insect pest, thereby controlling the insect pest.

Abstract: A multifunctional dendrimer nanoparticle and method of treating diseases of the posterior segment of the eye is presented. The functionalized polyamidoamine (PAMAM) dendrimer effectively delivers drugs and/or genes to the posterior eye, thereby providing for the effective, non-invasive, and topical treatment of diseased in the posterior eye. The multifunctional dendrimer nanoparticle has shRNA-encoding DNA and small molecule drug encapsulated cyclodextrin complexed to the outer surface of the dendrimer for delivery to the posterior segment of the eye.

Abstract: The present invention relates to a biosensor for detecting the presence and/or measuring the concentration of at least one biological agent, comprising a support on which a barcode is disposed, at least one area of which is functionalised by at least one aptamer capable of selectively immobilising said biological agent, said aptamer per se being directly or indirectly bonded to a pigment molecule capable either of producing colour, or of changing colour following the immobilisation of the biological agent by said aptamer.

Abstract: The invention relates to a new therapeutic application of pharmaceutically acceptable carriers containing miR222. In particular, the invention relates to the use of extracellular vesicles (EVs) which contain the microRNA miR222, in the treatment of fibrotic disease caused by hyperglycaemia, such as diabetic nephropathy and/or renal fibrosis.

Abstract: An antisense oligonucleotide capable of preventing or reducing exon 80 inclusion into a human COL7A1 mRNA, and methods for preventing or reducing exon 80 inclusion into a human COL7A1 mRNA.

Abstract: The present disclosure provides compositions and methods for reactivating latent immunodeficiency virus and/or reducing transcription of HIV integrated into the genome of an HIV-infected cell. The present disclosure provides compositions and methods for treating an immunodeficiency virus infection.

Abstract: The present invention relates to the treatment and/or prevention of a retinal disease by using a polynucleotide promoter wherein the polynucleotide or a variant thereof consists of the sequence (hRHOs-wt;?SEQ?ID?NO.?1) TCCTCCTAGTGTCACCTTGGCCCCTCTTAGAAGCCAATTAGGCCCTCAG TTTCTGCAGCGGGGATTAATATGATTATGAACACCCCCAATCTCCCAGA TGCTGATTCAGCCAGGAGCTTAGGAGGGGGAGGTCACTTTATAAGGGTC TGGGGGGGTCAGAACCCAGAGTCATCCAGCTGGAGCCCTGAGTGGCTGA GCTCAGGCCTTCGCAGCATTCTTGGGTGGGAGCAGCCACGGGTCAGCCA CAAGGGCCACAGCC? wherein the fragment TGAACACCCCCAATCTCCCAGATGCT which is the sequence from nucleotide 77 to nucleotide 102 of SEQ ID NO. 1, is substituted. The invention is also directed to the use of relative vector, vector systems, host cells and pharmaceutical compositions.

Abstract: The present invention relates to oligomeric compounds and conjugates thereof that target Proprotein Convertase Subtilisin/Kexin type 9 (PCSK9) PCSK9 mRNA in a cell, leading to reduced expression of PCSK9. Reduction of PCSK9 expression is beneficial for a range of medical disorders, such as hypercholesterolemia and related disorders.

Abstract: The presently-disclosed subject matter relates to RNA-based composition and method to treat breast cancer in a subject. More particularly, the presently disclosed subject matter relates to a RNA nanostructure and composition containing a multiple branched RNA nanoparticle, a breast cancer targeting module, and an effective amount of a breast cancer therapeutic agent. Further, the presently disclosed subject matter relates to a method of using the RNA nanoparticle composition to treat breast cancer in a subject having or at risk of having breast cancer.

Abstract: The present invention relates to an RNA encoding a therapeutic protein. In particular, the present invention relates to RNA suitable for use as a medicament. The present invention concerns such novel RNA as well as compositions and kits comprising the RNA. Furthermore, the present invention relates to the RNA, compositions or kits as disclosed herein for use as a medicament. The present invention also provides the use of the RNA, compositions or kits as disclosed herein far increasing the expression of said encoded protein, in particular in gene therapy.