Abstract: Novel thrombin-inhibitory proteins from terrestrial leeches of the genus Haemadipsa with the amino-acid sequence Ile-Arg-Phe-Gly-Met-Gly-Lys-Val-Pro-Cys-Pro-Asp-Gly-Glu-Val-Gly-Tyr-Thr-Cy s-Asp-Cys-Gly-Glu-Lys-Ile-Cys-Leu-Tyr-Gly-Gln-Ser-Cys-Asn-Asp-Gly-Gln-Cys-S er-Gly-Asp-Pro-Lys-Pro-Ser-Ser-Glu-Phe-Glu-Glu-Phe-Glu-Ile-Asp-Glu-Glu-Glu- Lys, or an amino-acid sequence which is obtained by C-terminal truncation of this sequence by from one to twelve amino acids, are described. The proteins are suitable for controlling diseases. Also described are the nucleic acids coding for these proteins.

Abstract: Human protein C derivatives with high activity and reduced dependence on thrombin activation are described. These derivatives differ from the native forms of human protein C in their increased activation rates, functional activities and carbohydrate structures. DNA compounds, transfer vectors, expression vectors and transformants useful in producing these derivatives are also described.

Abstract: This invention particularly provides a novel polypeptide having high protease-inhibiting activity, preferably FXa-inhibiting activity, which comprises, at least as a part of the polypeptide, an amino acid sequence resulting from substitution of an amino acid for at least one amino acid in the following amino acid sequence (1), wherein the amino acid substitution is at least one substitution selected from the following substitution means (i) to (iii). It also provides a process for the production of the polypeptide, a novel DNA fragment encoding the polypeptide and a drug composition containing the same.

Abstract: Mammalian melanin-concentrating hormone (MCH) is isolated from rat tissue, purified and characterized. These MCH peptides are useful for treating skin disorders, for suppressing the proliferation of skin tumor cells, such as melanomas in mammals, and for modulating the secretion of ACTH. Generally, peptides are provided which have the following formula: ##STR1## or which are naturally occurring homologs of the peptide with said formula. The peptides which are the naturally occurring MCH homologs of mammalian species other than rat can also be obtained using the materials disclosed, as demonstrated specifically with human MCH, which is found to have the same structure as rat MCH. Also disclosed are the amino acid sequences of, and the nucleotide sequences of the cDNAs which encode, the putative precursors of rat MCH and human MCH. These precursors may also include one or more biologically active peptides N-terminally of the mature MCH's.

Abstract: The present invention relates to a method to enhance a cell's ability to produce biotin precursors and/or biotin by deregulating at least one enzyme of the fatty acid biosynthetic pathway in the cell, preferably an enzyme that carries out an early step in the pathway. Preferably, the biotin biosynthetic pathway is also deregulated. The invention includes biotin-producing cells in which at least one enzyme of the fatty acid biosynthetic pathway is deregulated, preferably by transforming the cells with nucleic acid sequences encoding at least one of those enzymes; methods to produce such cells; and use of such cells to produce biotin.

Abstract: Two previously undescribed human cdc25 genes, designated cdc25 A and cdc25 B, which have been shown to have an endogenous tyrosine phosphatase activity that can be specifically activated by B-type cyclin, in the complete absence of cdc2.As a result of the work described herein, new approaches to regulating the cell cycle in eukaryotic cells and, particularly, to regulating the activity of tyrosine specific phosphatases which play a key role in the cell cycle are available. Applicant's invention relates to methods of regulating the cell cycle and, specifically, to regulating activation of cdc2-kinase, through alteration of the activity and/or levels of tyrosine phosphatases, particularly cdc25 phosphatase, and B-type cyclin or through alteration of the interaction of components of MPF, particularly the association of cdc25 with cyclin, cdc2 or the cdc2/cyclin B complex. The present invention also relates to agents or compositions useful in the method of regulating (inhibiting or enhancing) the cell cycle.

Abstract: The present invention provides isolated DNA molecules comprising a DNA segment encoding a novel human amyloid protein precursor homologue and novel Kunitz-type inhibitors. Also provided are DNA constructs comprising a first DNA segment encoding a novel human amyloid protein precursor homologue or a novel Kunitz-type inhibitor wherein said first DNA segment is operably linked to additional DNA segments required for the expression for the first DNA segment, as well as host cells containing such DNA constructs and methods for producing proteins from the host cells.

Abstract: The present invention relates to a monclonal antibody capable of suppressing the motility of cancer cells, a polypeptide recognizable by said anti-cancer antibody and its fragment peptides which is capable of suppressing the motility of cancer cells.The present invention also relates to a production and a use for preventing the matastasis of cancer thereof.

Abstract: The present invention provides chimeric proteins containing extracellular and transmembrane domains of CD4 and protein tyrosine kinases of the src family. Also provided are DNA molecules encoding the proteins of the present invention and cells containing such DNA molecules. The proteins and cells of the present invention may be employed in methods for identifying drugs that block T cell activation and for identifying low level self-antigens.

Abstract: The present invention relates to anti-thrombin polypeptides isolated from the leech Hirudinaria manillensis and to processes for their preparation. The polypeptides of the invention may be modified by way of amino acid extension at either or each end, and may be subjected to post-translational modification. The anti-thrombin polypeptides may be prepared by isolating them from the tissue or secretions of the leech Hirudinaria manillensis but they also may be synthetized by recombinant DNA methods. According to this latter aspect, the invention provides DNA sequences, expression vectors and host cell lines for the recombinant preparation of the polypeptides. The anti-thrombin polypeptides of the invention find an useful application in the treatment of venous thrombosis, vascular shunt occlusion and thrombin-induced disseminated intravascular coagulation.

Abstract: The present invention provides unique prepared immunogens, site-specific monoclonal antibodies against an epitope of progesterone receptor protein, and an immunoassay to determine the functional integrity of the progesterone receptors in a cellular sample. Collectively or individually the component parts of the invention provide the ability not only to identify accurately the presence of progesterone receptor but also the capability of determining whether the progesterone receptor exists in a clinically normal or abnormal state.

Abstract: The present invention discloses a primer for detecting methicillin-resistant or toxic shock syndrome toxin-1 Staphylococcus spp. comprising any one of nucleotide fragments of sequences (1) to (4):5'GAAATGACTGAACGTCCGAT (1)5'GCGATCAATGTTACCGTAGT (2)5'AGTATGGGCCAAAGTTCGAT (3)5'CACTTTGATATGTGGATCCG (4)a method and kit for detecting these bacteria using the primer. The present invention makes direct and rapid detection of MRS and/or TPS from samples possible, and enables patients with infections caused by these bacteria to be treated at an early stage.

Abstract: DNA encoding a novel human .beta..sub.2 integrin .alpha. subunit polypeptide, designated .alpha..sub.d, is disclosed along with methods and materials for production of the same by recombinant procedures. Binding molecules specific for .alpha..sub.d are also disclosed as useful for modulating the biological activities of .alpha..sub.d.

Abstract: A pure DNA encoding a peptide which is capable of promoting acrosome reaction and the encoded peptide. Also disclosed are a vector and a cell containing such a DNA, a pharmaceutical composition which includes such a peptide, a method of promoting fertilization using such a peptide, and a method of preparing such a peptide by recombinant technology.

Abstract: The present invention provides isolated DNA molecules comprising a DNA segment encoding a novel human amyloid protein precursor homolog and Kunitz-type inhibitor. Also provided are DNA constructs comprising a first DNA segment encoding a novel human amyloid protein precursor homolog or a Kunitz-type inhibitor wherein said first DNA segment is operably linked to additional DNA segments required for the expression for the first DNA segment, as well as host cells containing such DNA constructs and methods for producing proteins from the host cells.

Abstract: The present invention provides a protein that edits apo B RNA. A polynucleotide that comprises a DNA sequence that encodes an apo B RNA editing protein and an expression vector comprising such a polynucleotide are also provided. Processes for producing an apo B RNA editing protein, editing apo B RNA and altering apo B protein production are also provided.

Abstract: A soluble anticoagulant protein isolated and purified from Ancylostoma hookworms markedly prolongs both the prothrombin time and partial thromboplastin time in clotting assays. The protein has an apparent molecular weight of about 6500 daltons and exhibits amino acid sequence homology to the Kunitz-type serine protease inhibitor family. Chromogenic peptide substrate and clotting time assays indicate that the protein inhibits extrinsic pathway clotting factor VIIa, the enzyme responsible for initiating the human coagulation cascade, and factor Xa in the common pathway of the coagulation cascade.

Abstract: Peptides encoded by a substantially pure polynucleotide coding for an alpha and/or beta human globin, the globin when part of a hemoglobin molecule conferring lower oxygen affinity than normal hemoglobin to result in a mutant hemoglobin, the mutant hemoglobin having an oxygen affinity measured for stripped hemoglobin characterized by a P.sub.50 of 30 torr to 3 atmospheres and/or by a Hill coefficient between 2.5 and 1.0. Such mutant hemoglobin being useful to increase tissue oxygenation in a patient, to replace hemoglobin in the bloodstream of a patient and to treat patients suffering from burns.

Abstract: Disclosed and claimed are Bacillus thuringiensis isolates designated B.t. PS50C, B.t. PS86A1, B.t. PS69D1, B.t. PS72L1, B.t. PS75J1, B.t. PS83E5, B.t. PS45B1, B.t.. PS24J, B.t. PS94R3, B.t. PS17, B.t. PS62B1 and B.t. PS74G1 which are active against acaride pests. Thus, these isolates, or mutants thereof, can be used to control such pests. Further, genes encoding novel .delta.-endotoxins can be removed from these isolates and transferred to other host microbes, or plants. Expression of the .delta.-endotoxins in microbe hosts results in the control of acaride pests, whereas transformed plants become resistant to acaride pests.

Abstract: The present invention relates to peptides immunochemically reactive with antibodies to the Epstein-Barr virus (EBV), comprising at least part of the VCA-p18 or VCA-p40 protein, encoded within the EBV open reading frames BFRF3 and BdRF1 respectively, or a functional variant thereof. The invention further relates to nucleic acid sequences encoding these peptides, monoclonal antibodies against these peptides, cell lines capable of producing monoclonal antibodies and anti-idiotype antibodies. The invention also relates to recombinant vector molecules comprising a nucleic acid sequence according to the invention and host cells transformed or transfected with these vector molecules. The invention is further concerned with immunological reagents and methods for the detection of EBV or anti-EBV antibodies and a method for the amplification and detection of Epstein Barr viral nucleic acid.