Abstract: A mycoherbicidal delivery composition prepared from an inoculum of a fungal pathogen in an amount sufficient to control growth of an aquatic weed on a biocarrier comprising a plurality of discrete particles derived from a residual cell mass remaining fter lipids, proteins and sugars have been removed from oil seeds. The composition is formed as a cohesive, non-agglutinating dough which is shaped and dried to a low moisture content. The composition is shelf stable in dried form and can be used for targeted delivery of the mycoherbicide to an aquatic weed.

Abstract: An isolated and stable clone of mesangial cells which exhibit characteristics of diabetic cells when grown in normal glucose medium. The cells demonstrate an increase in glucose transport over normal mesangial cells and that provides a model for simulating diabetes in mesangial cells. Further, a stable, permanent clone of mesangial cells which underexpress GLUT1 mRNA and protein and which can be used therapeutically has been isolated.

Abstract: An adenoviral vector including at least one DNA sequence encoding a clotting factor, such as, for example, Factor VIII, or Factor IX. Such vectors may be administered to a host in an amount effective to treat hemophilia in the host. The vectors infect hepatocytes very efficiently, whereby the hepatocytes express the DNA sequence encoding the clotting factor.

Abstract: The present invention features biarsenical molecules and target sequences that specifically react with the biarsenical molecules. Bonding partners that include target sequences, vectors that include nucleic acid sequences that encode the target sequences and host cells that include the target sequences are also featured in the invention.

Abstract: The present invention provides for an antisense oligonucleotide having the sequence 5'GCTCGGCGCCGCCATTTCCAG3'(SEQ ID NO:1). The invention also provides for an antisense oligonucleotide having the sequence 5'GTCAGCGGCCATCAGCTT3'(SEQ ID NO:2). The present invention further provides for a method for treating a neurodegenerative disorder in a subject which comprises administering to the subject a compound in an amount effective to inhibit neuronal cell death and thus treat the neurodegenerative disorder in the subject, which compound comprises the oligonucleotide 5'GCTCGGCGCCGCCATTTCCAG3' (SEQ ID NO:1) and a delivery agent. The present invention provides for a method of inhibiting trophic factor withdrawal mediated death of a cell which comprises contacting the cell with an amount of the oligonucleotide 5'GCTCGGCGCCGCCATTTCCAG3' (SEQ ID NO:1) effective to inhibit death of the cell.

Abstract: This invention provides A method for preparing mutant genes, which comprises the steps of constructing a recombinant plasmid DNA by inserting a gene fragment into a plasmid DNA having a unidirectional origin, introducing the recombinant plasmid DNA into host cell lacking DNA error-correcting function to transform the host cell, and culturing the transformant cell in a condition that any mutations of the inserted gene is detectable. According to the present invention, diverse mutant genes can be prepared in a short period of time.

Abstract: The present invention relates to purified and isolated nucleic acid encoding the endo-.beta.-galactosidase from Flavobacterium keratolyticus (referred to as "ENDO-A"), and to purified ENDO-A protein. The endo-.beta.-galactosidase of the invention may be used in a process which enzymatically de-antigenizes human erythrocytes bearing A.sub.1 antigen. The resulting erythrocytes may be transfused into individuals who would be otherwise unable to tolerate a transfusion of type A.sub.1 blood.

Abstract: Naked nucleic acids (DNA, RNA, and/or analogs), drugs, and/or other molecules in an extracellular environment enter cells in living intact tissue upon application of pressure to the cells and extracellular environment. Nucleic acids localize to the cell nuclei. Transfection efficiencies greater than 90% are achievable for naked DNA and RNA. A sealed enclosure, defined by an enclosing means and/or tissue, contains the cells and their extracellular environment. The enclosure is pressurized to an incubation pressure on the order of atmospheres. A protective inelastic sheath may be used to prevent distension and trauma in tissue that is part of the enclosure boundary. Suitable enclosures include pressurization chambers and organs such as blood vessels or the heart. Parts of organs, entire organs, and/or entire organisms are pressurized. Suitable target tissue types include blood vessel (in particular vein) tissue, heart, kidney, liver, and bone marrow tissue.

Abstract: The present invention relates to a method for detecting or amplifying and detecting a target polynucleotide sequence. The method comprises providing in combination (i) a medium suspected of containing the target polynucleotide sequence, (ii) all reagents required for conducting an amplification of the target polynucleotide sequence when amplification is desired, and (iii) two oligonucleotide probes capable of binding to a single strand of the product of the amplification. At least one of the probes has two sequences that either (i) are non-contiguous and bind to contiguous or non-contiguous sites on the single strand or (ii) can bind to non-contiguous sites on the single strand. Each probe may contain a label. The combination is subjected to conditions for amplifying the target polynucleotide sequence. Next, the combination is subjected to conditions under which both of the probes hybridize to one of the strands to form a termolecular complex, which is detected by means of the label.

Abstract: A chimeric RNA molecule comprising at least one pre-mRNA processing element is disclosed. A gene construct comprising a DNA sequence encoding at least one pre-mRNA processing enhancer is also disclosed. A method of enhancing cytoplasmic RNA accumulation is disclosed. This method comprises the step of inserting a DNA sequence encoding the RNA into the vector described and expressing the DNA sequence.

Abstract: The present invention provides a method of increasing the production of a protein translated from an uncapped eukaryotic messenger ribonucleic acid (mRNA), comprising the steps of: selecting a nucleotide sequence encoding a protein to be expressed; joining nucleotides 1-168 of the barley yellow dwarf virus RNA, PAV serotype to the 5' untranslated region of said uncapped mRNA, said nucleotides 1-168 comprising the 5' untranslated region plus first 27 nucleotides of the open reading frame of the barley yellow dwarf virus RNA; linking nucleotides 4513-5677 of the barley yellow dwarf virus RNA, PAV serotype, to the 3' untranslated region of said uncapped mRNA; and expressing the protein.

Abstract: The present invention relates to an isolated protein or polypeptide corresponding to a coat protein or polypeptide of a grapevine leafroll virus. The encoding DNA molecule either alone in isolated form or in an expression system, a host cell, or a transgenic grape plant is also disclosed. Another aspect of the present invention relates to a method of imparting grapevine leafroll resistance to grape plants by transforming them with the DNA molecule of the present invention. A method for imparting tristeza virus resistance in citrus plants using the DNA molecule of the present invention is also disclosed.

Abstract: A nucleotide sequence comprising a transcriptional regulatory sequence and a sequence contiguous therewith and under the transcriptional control thereof, which contiguous sequence encodes an RNA which consists of a plurality of sub-sequences, characterized in that at least two of the sub-sequences have the sequences of viral RNAs and the RNA contains at least one translational stop codon located upstream of the 3' terminal sub-sequence. It is preferred that at least one of the sub-sequences is in an anti-sense configuration with respect to virus RNA, and that the contiguous sequence encodes mRNA. The invention also includes, inter alia, the use of such a sequence in the generation of virus resistant or tolerant plants, and such plants comprising the sequence.

Abstract: Checkpoint gene-defective human cells are useful for screening potential anti-tumor agents. Potential therapeutic agents are screened for the ability to cause DNA accumulation or cell death in a checkpoint gene-defective human cell.

Abstract: In a DNA base sequencing, a consensus sequence is obtained by linking a plurality of DNA fragments obtained by a DNA sequencer, and a base sequence to be edited is determined in the consensus sequence. Then, a trace corresponding to the determined base sequence to be edited is identified among traces obtained by the DNA sequencer. The identified trace is displayed in correspondence with the base sequence to be edited. At this time, the base sequence to be edited is displayed so that an interval between bases becomes even.

Abstract: Checkpoint gene-defective human cells are useful for screening potential anti-tumor agents. Potential therapeutic agents are screened for the ability to cause DNA accumulation or cell death in a checkpoint gene-defective human cell.

Abstract: A human lens epithelial cell line capable of expressing an exogeneous immortalizing gene, which is established without infecting with a live virus. A method for producing the human lens epithelial cell line, which comprises transfecting human lens epithelial cells with an expression vector functionally carrying an exogeneous immortalizing gene, and subculturing said cells in a medium. The above-mentioned human lens epithelial cell line wherein the cells proliferate in a temperature sensitive manner. A method for producing a temperature sensitive human lens epithelial cell line, which comprises transfecting human lens epithelial cells with an expression vector functionally carrying an exogeneous immortalizing gene, and subculturing said cells in a medium. Since the human lens epithelial cell line of the present invention is free of infection with a live virus, the cells are useful as biomaterials.

Abstract: A method is provided for performing saturation mutagenesis on a target gene by exploiting the immunoglobulin hypermutation system. A target gene is cloned into an expression vector containing immunoglobulin enhancer fragments that effect hypermutation, and this construct is then transfected into an immunoglobulin mutator cell, typically of pre-B lymphocyte lineage. The target gene is permitted to hypermutate at a rate approaching that of 10.sup.-4 /bp/generation as the cells are cultured to a desired density. The variant polypeptides encoded by the hypermutated target gene can then be selected.

Abstract: Checkpoint gene-defective human cells are useful for screening potential anti-tumor agents. Potential therapeutic agents are screened for the ability to cause DNA accumulation or cell death in a checkpoint gene-defective human cell.

Abstract: Checkpoint gene-defective human cells are useful for screening potential anti-tumor agents. Potential therapeutic agents are screened for the ability to cause DNA accumulation or cell death in a checkpoint gene-defective human cell.