Abstract: Provided herein are systems and methods for Inducible and conditional CRISPR/Cas9 and RNAi. From animal model creation and the efficiency of CRISPR-based targeting, the present invention comprises developing RNAi models that enable inducible and reversible gene silencing to simulate new therapeutic regimes.

Abstract: Disclosed are polynucleotides, compositions, and methods related to RNA interference (RNAi). Particular disclosed are toxic RNAi active seed sequences and methods of using toxic RNAi active sequences for killing cancer cells. The disclosed toxic RNAi active seed sequences preferentially target and inhibit the expression of multiple essential genes for cell survival and/or growth through a process called “death-induced by survival gene elimination” or “DISE.” The disclosed toxic RNAi active seed sequences may be referred to as “dual activity super toxic RNAi active dsRNAs” that include a toxic first strand and a toxic second strand that is complementary to the toxic first strand. As such, the disclosed dsRNAs may be expressed as shRNAs which are processed for RNA interference (RNAi) and either of the toxic first strand and the toxic second strand can function as a guide strand to initiate RNAi.

Abstract: The invention provides siRNA molecules for use in controlling pest infestation. The siRNA molecules target the mature mRNA of D. noxia cprr1-8 in a region between nucleotides 464 and 774 of SEQ ID NO: 23, or an equivalent region of an ortholog of D. noxia cprr1-8. Ingestion of the siRNA molecule by a pest inhibits the biological activity of the pest. In one embodiment, the siRNA molecule comprises a polynucleotide which has at least 80% sequence identity to the sequence 5? UAAACAAUCGCAAGAAGCUGA 3? (SEQ ID NO: 1) and a polynucleotide which has at least 80% sequence identity to the sequence 5? AGCUUCUUGCGAUUGUUUAAG 3? (SEQ ID NO: 2). Compositions comprising the siRNA molecules, vectors encoding the siRNA molecules, and methods for using the siRNA molecules are also provided.

Abstract: Compositions and methods for efficiently generating and identifying accurate homologous recombination events are disclosed.

Abstract: The present invention provides compositions and methods for inhibiting one or more diacylglycerol kinase (DGK) isoform in a cell in order to enhance the cytolytic activity of the cell. In one embodiment, the cells may be used in adoptive T cell transfer. For example, in some embodiments, the cell is modified to express a chimeric antigen receptor (CAR). Inhibition of DGK in T cells used in adoptive T cell transfer increases cytolytic activity of the T cells and thus may be used in the treatment of a variety of conditions, including cancer, infection, and immune disorders.

Abstract: Aspects of the disclosure relate to a gene therapy approach for diseases, disorders, or conditions caused by mutation in the stop codon utilizing modified tRNA. At least 10-15% of all genetic diseases, including muscular dystrophy (e.g. Duchene muscular dystrophy), some cancers, beta thalassemia, Hurler syndrome, and cystic fibrosis, fall into this category. Not to be bound by theory, it is believed that this approach is safer than CRISPR approaches due to minimal off-target effects and the lack of genome level changes.

Abstract: A method produces a hairpin single-stranded RNA molecule capable of inhibiting expression of a target gene, the method including: (i) an annealing step of annealing a first single-stranded oligoRNA molecule and a second single-stranded oligoRNA molecule; and (ii) a ligation step of ligating 3? end of the first single-stranded oligoRNA molecule and 5? end of the second single-stranded oligoRNA molecule by an Rnl2 family ligase, wherein a sequence produced by ligating the first single-stranded oligoRNA molecule and the second single-stranded oligoRNA molecule includes a gene expression-inhibiting sequence for the target gene.

Abstract: Non-human animal cells and non-human animals comprising a humanized TTR locus comprising a beta-slip mutation and methods of using such non-human animal cells and non-human animals are provided. Non-human animal cells or non-human animals comprising a humanized TTR locus comprising a beta-slip mutation express a human transthyretin protein or a chimeric transthyretin protein, fragments of which are from human transthyretin. Methods are provided for using such non-human animals comprising a humanized TTR locus to assess in vivo efficacy of human-TTR-targeting reagents such as nuclease agents designed to target human TTR.

Abstract: Provided herein are polynucleotides comprising sequence configured to bind to a CRISPR effector protein. Modulation of one or more modifications of the polynucleotides can be used to tune the activity of CRISPR effector proteins complexed with the polynucleotides.

Abstract: RNAi agents for inhibiting the expression of the alpha-1 antitrypsin (AAT) gene, compositions including AAT RNAi agents, and methods of use are described. Also disclosed are pharmaceutical compositions including one or more AAT RNAi agents together with one or more excipients capable of delivering the RNAi agent(s) to a liver cell in vivo. Delivery of the AAT RNAi agent(s) to liver cells in vivo inhibits AAT gene expression and treats diseases associated with AAT deficiency such as chronic hepatitis, cirrhosis, hepatocellular carcinoma, transaminitis, cholestasis, fibrosis, and fulminant hepatic failure.

Abstract: The present disclosure relates to polynucleotides encoding tethered interleukin-12 (IL-12) polypeptides comprising an IL-12 polypeptide and a membrane domain. The present disclosure also relates to vectors comprising the polynucleotides; host cells comprising the polynucleotides or vectors, polypeptides encoded by the polynucleotides; compositions comprising the polynucleotides, vectors, host cells, or polypeptides and a delivery agent; and uses thereof, including treatment of cancer.

Abstract: Alternative splicing events in SCN1A gene can lead to non-productive mRNA transcripts which in turn can lead to aberrant protein expression, and therapeutic agents which can target the alternative splicing events in SCN1A gene can modulate the expression level of functional proteins in Dravet Syndrome patients and/or inhibit aberrant protein expression. Such therapeutic agents can be used to treat a condition caused by SCN1A, SCN8A or SCN5A protein deficiency.

Abstract: The present invention relates, in part, to methods of treating a subject afflicted with a cancer comprising administering to the subject a therapeutically effective amount of an agent that inhibits or promotes the copy number, the expression level, and/or the activity of one or more biomarkers listed in Table 1 or a fragment thereof. Also provided herein are methods of detecting ADAR1 or ISG15 dependency in a high proliferation cell (e.g., a cancer cell). Also provided are methods of detected increased interferon signaling pathway activity in a high proliferation cell (e.g., a cancer cell). Included herein are methods of treating cancer with inhibitors of ADAR1 or ISG15. Methods of screening for such inhibitors are also provided herein. Methods of identifying the likelihood of a cancer to be responsive to an ADAR1 inhibitor are also provided.

Abstract: An antiviral agent is provided, having a phosphorodiamidate morpholino oligomer with an antisense sequence to a portion of a genome of a strain of Zika virus (ZIKV). The antiviral agent finds many uses, such as in a pharmaceutical composition, a method of treating ZIKV-mediated disease, a method of preventing ZIKV-mediated disease, a method of reducing or preventing the replication of ZIKV in a host cell, a method of controlling the spread of ZIKV in donated tissue, a treated tissue sample, and in the manufacture of a medicament for the treatment or prevention or ZIKV-mediated disease.

Abstract: The disclosure provides for eRNA-targeted transcriptional reprogramming through targeted reduction of eRNAs for a clinically relevant gene, TNFSF10, resulting in a selective control of interferon-induced apoptosis. A method of inhibiting a TNFSF10 gene expression in a human cell is disclosed. The methods described herein comprise contacting the human cell with a single-stranded antisense compound consisting of the sequence selected from a set of SEQ ID NOs: disclosed herein, wherein the antisense compound targets an enhancer RNA (eRNA) transcribed from a genomic enhancer sequence or region. The eRNA is an TNFSF10 eRNA sequence comprising the nucleic acid sequence selected from the SEQ ID NOs disclosed herein which inhibits expression of the TNFSF10 gene in the human cell.

Abstract: This invention discloses the use of non-coding RNA SNHG17 as a biomarker and a therapeutic target that relates to the technical field of tumor biotherapy. This invention discloses a use of the non-coding RNA SNHG17 for the manufacture of a detection agent for predicting the drug resistance of fulvestrant. This invention also discloses the use of shRNA for inhibiting non-coding RNA SNHG17 expression. This shRNA can knockdown the expression of the non-coding RNA SNHG17 efficiently. In this way, the sensitivity of fulvestrant-resistant breast cancer cells can be increased. So this invention has good prospects for drug development.

Abstract: The present invention relates to a novel compound and application thereof in the inhibition of HBV gene expression. The structure of the compound comprises an interfering nucleic acid for inhibiting HBV gene expression, transition points, and delivery chains of the interfering nucleic acid. By means of the delivery chains, two or three N-acetylgalactosamines can be introduced to an antisense strand 3? end of such siRNA, and two or one N-acetylgalactosamine can be correspondingly introduced to a sense strand 5? end, the total number of the introduced N-acetylgalactosamines being four. In vitro and in vivo pharmacological experiments prove that such a novel compound can continuously and efficiently inhibit HBV gene expression.

Abstract: The present invention relates to a double-helix oligonucleotide construct comprising a double-stranded miRNA and a composition for preventing or treating cancer comprising the same. More particularly, the present invention relates to a double-helix oligonucleotide construct comprising miR-544a characterized by a method that effectively inhibits the proliferation of cancer cells or induces a voluntary death of cancer cells, and an anticancer composition comprising the construct.

Abstract: This invention relates to a method for diagnosing and/or prognosticating HER2-dependent cancer in a subject, comprising a) measuring the amount of one or more miRNA selected from the group consisting of miRNA 429-3p, miRNA 29c-3p, miRNA 29a-3p, miRNA 29b-3p, miRNA 200a-3p, miRNA 200b-3p, miRNA 200c-3p, miRNA 141-3p, miRNA 15a-5p, miRNA 15b-5p, miRNA 16-5p, miRNA 424-5p, miRNA 497-5p, miRNA 615-3p, miRNA 451a-3p and miRNA 542-5p in a sample from the subject; b) comparing the amount of one or more miRNA measured in step a) to a reference value; c) finding a deviation or no deviation of the amount of one or more miRNA measured in step a) from the reference value; and d) attributing said finding of deviation or no deviation to a particular diagnosis and/or prognosis of HER2-dependent cancer in the subject.

Abstract: Presented are RNA nucleotide sequences referred to as EXO-Codes, and longer RNA polynucleotides that contain the EXO-Codes. EXO-Codes provide RNA with the ability to a) be selectively sorted to extracellular vesicles such as exosomes, and b) deliver a variety of cargo types to program or reprogram the extracellular vesicles, and cells that receive the exosomes. Also presented are methods of making the EXO-Codes, modifying cells using the EXO-Codes, expression vectors encoding the EXO-Codes, and exosomes and other secreted vesicles that include RNA polynucleotides that contain the EXO-Codes.