Abstract: The present invention relates to a method for determining the relative abundance of individual species or lower phylogenetic subgroups of microorganisms in a mixed population of several microorganisms comprising the steps of: 1) providing a set of labeled in situ hybridization cluster oligonucleotide probes; 2) hybridization of said probes with a sample of the mixed population, and 3) quantitative analysis of the number of labeled microorganisms. Further it relates to a method for analyzing dynamics in relative abundance of individual microorganisms in a mixed population.

Abstract: A method of sorting mixtures of nucleic acid strands comprising hybridizing the strands to an array of immobilized oligonucleotides, each of which includes a constant segment adjacent to a variable segment. The constant segment of the immobilized oligonucleotides can be made complementary to the ends of strands obtained by digesting a double-stranded nucleic acid with a restriction enzyme and restoring the restriction sites, thereby permitting the sorting of strands according to their variable sequences adjacent to their constant terminal restored restriction sites.

Abstract: A composition for the transfection of higher eucaryotic cells, comprising complexes of nucleic acid, a substance having an affinity for nucleic acid and optionally an internalizing factor, contains an endosomolytic agent, e.g. a virus or virus component, which may be conjugated. The endosomolytic agent, which is optionally part of the nucleic acid complex, is internalized into the cells together with the complex and releases the contents of the endosomes into the cytoplasm, thereby increasing the gene transfer capacity. Pharmaceutical preparations, transfection kits and methods for introducing nucleic acid into higher eucaryotic cells by treating the cells with the composition are also disclosed.

Abstract: A thermal cycling device comprising a ceramic sample plate, and method of use thereof, is provided.

Abstract: Disclosed is a method for determining a nucleotide sequence of DNA product amplified by polymerase chain reaction not requiring removal of primers and/or 2'-deoxyribonucleoside-5'-triphosphates and/or derivatives thereof, which comprises reacting ribonucleoside-5'-triphosphates comprising ATP, GTP, CTP, UTP and derivatives thereof and one or more of 3'-deoxyribonucleotide-5'-triphosphates comprising 3'-dATP, 3'-dGTP, 3'-dCTP, 3'-dUTP and derivatives thereof in the presence of an RNA polymerase and a DNA product which has been amplified by polymerase chain reaction and contains a promoter sequence for the RNA polymerase to afford a nucleic acid transcription product, separating the obtained nucleic acid transcription product and determining a nucleic acid sequence from the resluting separated fractions.

Abstract: Methods, devices, apparatus and kits for amplifying and detecting nucleic acid are provided. The apparatus is a one or two-tier thermal cycling device that operates in conjunction with a reaction/detection unit. A sample is loaded into a reaction chamber of the device which is then mated with a detection chamber to form the reaction/detection unit. A first heating element of the thermal cycling apparatus applies a desired temperature to the reaction/detection device to amplify target nucleic acid in the sample. The reaction mixture is then transferred to the detection chamber by the second heating element and amplified target nucleic acid is immobilized on a support in the detection chamber. Microprocessor control controls the heat applied by the second element independently of the heat applied by the first element. A detection system associated with the apparatus detects and analyzes the immobilized amplified nucleic acid target.

Abstract: Methods for determining quantities of nucleic acid sequences in samples undergoing amplification utilize amplification ratio estimates (R*) in operations to accurately perform absolute quantitation even when amplification factors for the target and control sequences undergoing amplification are different, time dependent or vary as a function of starting concentrations of nucleic acid sequences. These operations also take into account conversion efficiencies associated with the conversion of probes upon generation of target or control amplicons, but do not require the explicit calculation of such efficiencies. The operations also recognize that a preferred R* should be determined based on a preferred statistical criterion to improve quantitation. In addition, the use of standard samples having known starting concentrations of target and control sequences therein may enable accurate absolute quantitation without the explicit calculation of amplification ratio estimates.

Abstract: Method of detecting a nucleic acid by converting the nucleic acid into a single-stranded nucleic acid under alkaline conditions, wherein at least one detergent from the group of anionic, non-ionic and zwitterionic detergents is present, adding an immobilizable or immobilized capture probe, hybridizing the capture probe with the nucleic acid under immobilization of the nucleic acid via the capture probe and detecting the amount of synthesized, immobilized hybrid.

Abstract: Two mutations in the human cardiac actin gene are disclosed which have been associated with idiopathic dilated cardiomyopathy (IDC) in two families. These mutations cosegregate with IDC in the two families. Both mutations affect universally conserved amino acids in domains of actin that attach to Z bands and intercalated discs. Analysis of the cardiac actin gene can be used to determine the presence in a patient of IDC resulting from mutations in this gene. Such analysis is useful in the diagnosis and prognosis of the disease in patients with mutations in this gene.

Abstract: The invention provides a purified and isolated Cryptosporidium DNA sequence comprising the nucleotide sequence:GATGGTACTGGATAGATAGTGGAAGTCCCGTATCAGTTCGAGATTCTGAAATTA ATTGGACATCAAGTTATAAAGCAAGCTGGTTATTAAGATTCAAATTTCCCTTTGA AAAGTGTGGCTTTTTTGATATTGGAGGGTTAGGAAGAAGGTT plus methods and kits for detecting and/or identifying the presence of Cryptosporidium.

Abstract: A step-wise integrated process for identifying sequence variations in polynucleotide sequences is disclosed. The identification process is composed of three stages, including allele specific hybridization assays of known sequence variations (Stage I), sequence variation locating assays (Stage II), and direct sequencing (Stage III). The methods can be used for efficient and accurate detection of mutations in any test gene sample.

Abstract: A computational method maximizing open reading frame length in an assembly consensus sequence is provided. Systems employing the method are also provided.

Abstract: Amplification primers and methods for specific amplification and detection of a Shiga-like toxin II (SLT-II) target are disclosed. The primer-target binding sequences are useful for amplification and detection of SLT-II target in a variety of amplification and detection reactions.

Abstract: Nucleic acids encoding each of three subunits, .alpha.1B, .alpha.2.delta., and .beta.3, of a calcium channel, are disclosed. Also disclosed are vectors containing the nucleic acids encoding the subunits; host cells containing the nucleic acids encoding the subunits; methods of isolating nucleic acids encoding related calcium channel subunits; the subunit proteins; fusion proteins comprising the subunit proteins; antibodies to the subunit proteins; assays to identify agents that modulate calcium channel activity, and agents identified thereby; methods of treating certain central nervous system disorders by altering calcium channel activity; and methods of diagnosing diseases associated with particular calcium channels, such as Lambert-Eaton syndrome.

Abstract: Provided is a method of detecting transmissible spongiform encephalopathies. The method comprises: selecting a sample from a subject to determine whether the subject has a transmissible spongiform encephalopathy; and detecting spiroplasma-specific 16S rDNA indicative of transmissible spongiform encephalopathies in the sample. The spiroplasma-specific 16S rDNA is preferably detected by contacting the sample with a pair of oligonucleotide primers under polymerase chain reaction conditions and detecting the resulting polymerase chain reaction product, wherein each of the pair of the oligonucleotide primers is complementary to spiroplasma-specific 16S rDNA indicative of transmissible spongiform encephalopathies.

Abstract: A method of improving the synthesis of full-length cDNA transcripts by Mn.sup.++ -dependent reverse transcriptases, preferably DNA-dependent DNA polymerases, is disclosed.

Abstract: This invention relates to a method of detection of an mRNA having HPV and cellular sequences in a body sample, comprising the following steps:(a) obtaining a body sample;(b) isolating mRNA from the body sample of (a);(c) translating the mRNA of (b) into cDNA using a primer common for reverse transcription;(d) amplifying the cDNA of (c) by a PCR reaction with a 5' HPV primer and a 3' primer having sequences of the primer of (c);(e) cleaving the amplified cDNA of (d) with an endonuclease cleaving on the 5' side of the HPV polyadenylation sequence;(f) amplifying the non-cleaved cDNA of (e) with the primers of (d) or with "nested" primers; and(g) detecting the amplified cDNA of (f).Furthermore, this invention concerns the use of such a method of early detection of HPV-associated carcinomas and extreme dysplasias caused by HPV, respectively.

Abstract: Method and kit for the quantitative detection of specific oligonucleotide or polynucleotide sequences which is characterized in that a sample mixture containing RNA or single-stranded DNA is hybridized with an oligonucleotide or polynucleotide probe(s) which are complementary to the nucleotide sequence to be determined and carry(ies) a specificplly bindable and a detectable chemical group subsequently it is admixed with an agent that cleaves single-stranded polynucleotide sequences and the immobilized or non-immobilized nucleotide probe is determined after transfer into a suitable reaction vessel. It has proven to be particularly advantageous when a mixture is used which is composed of different cleaving reagents.