Abstract: Various exemplary compounds, compositions, methods and devices are disclosed. An exemplary composition or formulation includes methyl anthranilate, fatty acid and an amine such as, but not limited to, monoethanolamine or triethanolamine. Such an exemplary composition is optionally an emulsion. An exemplary method applies an exemplary compound to an insect nest. Such an exemplary compound may be in a composition or formulation. Exemplary compounds optionally include semiochemicals of insects, plants and/or animals. Other exemplary compounds, compositions, methods and devices are also disclosed.

Abstract: The present invention is directed to nuclear factor ?B (NF?B)-inducing factor polypeptides (NFIF polypeptides) which are capable of inducing NF?B. The present invention includes within its scope NFIF polypeptides, including NFIF-14b and NFIF-7a, DNA, including cDNA, encoding these polypeptides, and expression vectors capable of expressing NFIF polypeptides. Also included are methods and compositions for increasing NF?B induction in a patient, methods and compositions for lowering NF?B induction in a patient, methods for inhibiting inflammation, and methods for manufacture of a medicament intended for the treatment and/or prevention of an NF?B-regulated inflammatory response. In addition, methods for determining whether a test compound inhibits or enhances the activity of NFIF polypeptides are provided.

Abstract: A structured drug system that is useful for delivering a drug payload to a specific tissue or cell type is disclosed. The system is based on purified polymalic acid. This polymer isolated from natural sources is biocompatible, biodegradable and of very low toxicity. The polymer is extremely water soluble and contains a large number of free carboxyl groups which can used to attach a number of different active molecules. In the examples disclosed N-hydroxysuccinimide esters of the carboxyl groups are used to attach such molecules. The active molecules include monoclonal antibodies to promote specific cellular uptake and specific pro-drugs such as antisense nucleic acids designed to modify the cellular metabolism of a target cell. The pro-drugs are advantageously linked by a somewhat labile bond so that they will be released under specific conditions. In addition, the system contains amide-linked valine to encourage membrane disruption under lysosomal conditions.

Abstract: The present invention provides a DNA participating in biological transformation of a macrolide compound 11107B. The present invention provides, particularly, a DNA participating in biological transformation of a macrolide compound 11107B represented by the formula (I) into a 16-position hydroxy macrolide compound 11107D represented by the formula (II), the DNA encoding a protein having 16-position hydroxylating enzymatic activity or ferredoxin, to a method of isolating the DNA, to a protein encoded by the DNA, a plasmid carrying the DNA, a transformant obtained by transforming using the plasmid and a method of producing a 16-position hydroxy compound by using the transformant.

Abstract: This invention relates to modified double-stranded oligoribonucleic acid (dsRNA) having improved stability in cells and biological fluids, and methods of making and identifying dsRNA having improved stability, and of using the dsRNA to inhibit the expression or function of a target gene.

Abstract: Disclosed herein is a novel forward mutation assay based on 5-fluorouracil (5-FU) resistance which utilizes a strain of Salmonella typhimurium derived from the Ames strain TA100. More specifically, the invention provides a high throughput alternative to the standard Ames mutation assay for the evaluation of the genotoxicity activity of compounds during an early stage of the drug development process. The invention also identifies the upp locus as a mutational target that is capable of detecting a diverse spectrum of mutagenic events and further describes a S. typhimurium tester strain, designated FU100 (his+, rfa, ?uvrB, pkM101, 5-fluorouridine resistant) for use in the assay of the invention.

Abstract: Methods and compounds for increasing or decreasing mucus secretion in subjects, and particularly mucus secretion in the airways, are described. Methods of screening compounds for the ability to increase or decrease mucus secretion are also described.

Abstract: Described is an immunostimulatory oligodeoxynucleic acid molecule (ODN) having the structure according to formula (I), wherein any X is O or S, any NMP is a 2? deoxynucleoside monophosphate or monothiophosphate, selected from the group consisting of deoxyadenosine-, deoxyguanosine-, deoxyinosine-, deoxycytosine-, deoxyuridine-, deoxythymidine-, 2-methyl-deoxyinosine-, 5-methyl-deoxycytosine-, deoxypseudouridine-, deoxyribosepurine-, 2-amino-deoxyribosepurine-, -6-S-deoxyguanine-, 2-dimethyl-deoxyguanosine- or N-isopentenyl-deoxyadenosine-monophosphate or -monothiophosphate, NUC is a 2? deoxynucleoside, selected from the group consisting of deoxyadenosine-, deoxyguanosine-, deoxyinosine-, deoxycytosine-, deoxyuridine-, deoxythymidine-, 2-methyl-deoxyinosine-, 5-methyl-deoxycytosine-, deoxypseudouridine-, deoxyribosepurine-, 2-amino-deoxyribosepurine-, 6-S-deoxyguanine-, 2-dimethyl-deoxyguanosine- or N-isopentenyl-deoxyadenosine, any X is O or S, a and b integers from 0 to 100 with the proviso that a+b is betwe

Abstract: The invention provides a method for making in vitro peptide expression libraries, and for the isolation of nucleotide sequences encoding peptides of interest, wherein the peptides or proteins are specifically associated with the DNA encoding them through non-covalent protein:DNA binding. The method describes ways of making the library itself, DNA molecules encoding the library and uses of the expression library.

Abstract: The object of the present invention is to provide a nucleoside or nucleotide having an unnatural base. The nucleoside or nucleotide of the present invention has a 5-substituted-2-oxo(1H)-pyridin-3-yl group as a base. Preferably, the 5-position of the above base is substituted with a substituent selected from the group consisting of the following: 1) a photoreactive group selected from iodine and bromine; 2) an alkenyl group, an alkynyl group or an amino group, or a derivative thereof; 3) biotin or a derivative thereof; and 4) a fluorescent molecule selected from fluorescein, 6-carboxyfluorescein, tetramethyl-6-carboxyrhodamine, and derivatives thereof.

Abstract: An immunostimulatory oligonucleotide that is represented by the general formula 5?-Gm-GACGATCGTC-Gn-3? or 5?-Gm-CACGATCGTG-Gn-3? (in the formula, m and n are each independently an integer from 1 to 9 and m+n=10) and that comprises any of the following base sequences: GGACGATCGTCGGGGGGGGG (SEQ. ID. NO.: 1), GGGACGATCGTCGGGGGGGG (SEQ. ID. NO.: 2), GGGGACGATCGTCGGGGGGG (SEQ. ID. NO.: 3), GGGGGGGACGATCGTCGGGG (SEQ ID NO: 4), GGGGGGGGACGATCGTCGGG (SEQ. ID. NO.: 5), GGGGGGGGGACGATCGTCGG (SEQ. ID. NO.: 6), GGGGGGGGGGACGATCGTCG (SEQ. ID. NO.: 7), and GGGGGGGGGCACGATCGTGG (SEQ. ID. NO.: 8).

Abstract: The use of 7-ter-butoxyiminomethylcamptothecin is described in the preparation of a medicament useful for the treatment of uterine neoplasms, particularly cancer of the endometrium and of the neck of the womb.

Abstract: This invention relates to antisense oligonucleotides that target mRNAs in cells as substrates for the cellular enzyme RNase H and thereby cause specific degradation of the targeted mRNA. The oligonucleotides have three components: an RNase H activating region, a complementary region and 3? and 5? ends. The invention optimizes each of the components to resist intracellular nucleases, to increase hybridization to target mRNA, to specifically inactivate target mRNA in cells, and to decrease cytotoxicity.

Abstract: The present invention relates to a method of stabilizing and/or isolating nucleic acids, wherein a biological sample containing nucleic acids is contacted with a cationic compound. The invention also relates to said cationic compound per se and to the use of said cationic compound in stabilizing and/or isolating nucleic acids. Furthermore, the invention relates to pharmaceutical compositions, diagnostic compositions, and to compositions used in research, which include cationic compounds or a complex being formed upon contact of said cationic compound with a nucleic acid.

Abstract: The present invention relates to novel miRNA molecules, more particularly to novel miRNA molecules isolated from human embryonic stem cells. The miRNA molecules provided by the present invention can be usefully used as a molecular marker for early developmental stages of undifferentiated human embryonic stem cells. Also, the miRNA molecules of the present invention may play an important role in the regulation of mammalian embryonic stem cells. Therefore, the miRNA molecules can be usefully used for analyzing regulatory networks of human embryonic stem cells.

Abstract: The present invention relates to novel types of peptide nucleic acids (PNAS) with improved properties. In particular, it relates to positively charged PNA units having an ethylene linker between the backbone and the nucleobase, to oligonucleotide analogs comprising these units, to oligomers comprising these units, and to the use of positively charged PNAs as novel delivery agents with therapeutic and diagnostic applications including for antisense therapy.

Abstract: Sterically stabilized cationic liposomes (SSCL) encapsulating a K type oligodeoxynucleotide (ODN) including a CpG motif are disclosed. These SSCL encapuslating a K type ODN can be used to effectively deliver the ODN to a cell. A novel method is also disclosed for producing the SSCL encapsulating the K type ODN. Administration of the SSCL encapsulating a K type ODN and a chemotherapeutic agent, such as a chimeric molecule comprising a targeting molecule selected from the group consisting of an IL-13, and an anti-IL-13 receptor antibody; and an effector molecule selected from the group consisting of a Pseudomonas exotoxin, a Diphtheria toxin, and a radionuclide, can be used to dramatically reduce the growth of solid tumors.

Abstract: The invention relates to anti-apoptotically active apatamers. The invention describes possible therapeutic and diagnostic applications for, among other things, treating arteriosclerosis, promoting the healing of wounds, treating AIDS, cancer, Alzheimer's disease, systemic lupus erythematosus as well a rheumatoid arthritis and other chronic inflammatory diseases.

Abstract: New chemotherapeutic medicaments and certain medical uses and methods for use of such chemotherapeutic medicaments for treatment of disease in human or animal tissue are described, wherein a primary active component of such medicaments is a halogenated xanthene or halogenated xanthene derivative. Preferably, the halogenated xanthene is Rose Bengal or a functional derivative of Rose Bengal. The halogenated xanthenes constitute a family of useful chemotherapeutic agents that afford selective, persistent accumulation in certain tissues.

Abstract: The invention discloses novel promoter sequences capable of expressing genes in plant cells. The promoters include engineered versions of the maize ubiquitin promoter to increase expression levels beyond those observed with the native ubiquitin promoter and alter the tissue preference. Expression constructs, vectors, transgenic plants and methods are also disclosed.