Abstract: A method for isolating a rare cell type from a sample including a mixed population of cells is provided, which employs (a) an image processor being designed for morphologically differentiating the rare cell type from the mixed population of cells; (b) a magnifying device communicating with the image processor for providing a magnified image of at least a portion of the sample to the image processor; and (c) a micromanipulator for retrieving the rare cell type out of the mixed population of cells according to information provided by the image processor.

Abstract: The present invention is directed to the simultaneous amplification of multiple distinct genetic loci using PCR or other amplification systems to determine in one reaction the alleles of each locus contained within the multiplex.

Abstract: Intragenic suppressor mutations of common p53 mutations are able to function in cis and/or trans. These mutations are useful for identifying small molecule drugs which function in a similar fashion. In addition, the mutations themselves may be useful therapeutically, especially if they function in trans. Methods for rapidly obtaining this type of mutant employ a yeast selection system. Cells having both the negative mutation and intragenic suppressor are useful for studying the interactions of the two, in particular in determining the structure of the homotetramers and heterotetramers.

Abstract: A general method for screening genomic or cDNA, or fragments and mixtures thereof, involves sample simplification by the generation of subsets and then subjecting the subsets to a modified mismatch scanning procedure that eliminates DNA having single stranded breaks after a MutSLH cleavage. The methods are particularly useful in human population isolates, including identification of identical-by-descent sequences, genomic comparisons of two or more individuals, and genomic comparisons of two populations of individuals, for the identification of sequences of low polymorphism.

Abstract: Oligonucleotide molecules and methods are disclosed for the detection of viable oocysts or other cells of the protozoa species, Cyrptosporidium parvum. Preferred oligonucleotide molecules are selected from the group comprising oligonucleotides having one or more of the following sequences: (a) ACA ATT ATT, (b) CTT TTT GGT, (c) ATT TTA TAT AAA ATA TTT TGA TGA A, (d) TTT TTT TTT TTA GTA T, (e) TAT ATT TTT TAT CTG, (f) CTT TAC TTA CAT GGA TAA CCG, or comprising a part of the sequences (a) to (f) above so as to allow specific hybridization to unique 18S rRNA sequences of C. parvum.

Abstract: The present invention is drawn to nucleic acid fragments specific to Xanthomonas campestris pathogenic to plants belonging to the family Gramineae, as well as methods for detecting the pathogenic Xanthomonas campestris using the same. The nucleic acid fragment of the invention has a nucleotide sequence which is at least 15 consecutive nucleotides of the nucleotide sequence shown in SEQ ID NO:1 or in the complementary chain thereof, or has no less than 15 nucleotides and hybridizes with the nucleic acid having the sequence shown in SEQ ID NO:1 or with the complementary chain thereof under stringent conditions.

Abstract: The present invention relates to methods and compositions for the diagnosis, prevention, and treatment of tumors and cancers (e.g., colon cancer) in mammals, e.g., humans. The invention is based on the discovery of genes that are differentially expressed in tumor cells relative to normal cells. The genes identified can be used diagnostically or as targets for therapy, and can be used to identify compounds useful in the diagnosis, prevention, and therapy of tumors and cancers.

Abstract: A probe that is a labelled segment of RNA complementary to and capable of specifically hybridizing with denatured HCV RNA, and prepared from 5' sense, GGCGACACTCCACCATGAAT and 3' antisense, ccagagcatctggcacgtgg primers, from the 5' untranslated region of the HCV genome, is employed for detecting and identifying the presence of hepatitis C virus (HCV) in tissue.