Abstract: According to the present invention, plant choline monooxygenase and the gene thereof are provided. The present invention discloses the following recombinant proteins (a) and (b) as well as genes encoding the proteins: (a) comprising the amino acid sequence shown in SEQ ID NO: 2, 4 or 6; (b) comprises the amino acid sequence shown in SEQ ID NO: 2, 4 or 6 having deletion, substitution or additon of one or several amino acids, and which has choline monooxygenase activity.

Abstract: Inhibitors of human Akt3, including antisense oligonucleotides, methods, and compositions specific for human Akt3, are provided. Methods of using the compositions for modulating Akt3 expression and for regulating cell growth, particularly tumor cell growth, are also provided.

Abstract: Compositions and methods for the treatment and diagnosis of diseases or disorders amenable to treatment through modulation of expression of a gene encoding a Jun N-terminal kinase (JNK protein) are provided. Oligonucleotide are herein provided which are specifically hybridizable with nucleic acids encoding JNK1, JNK2 and JNK3, as well as other JNK proteins and specific isoforms thereof. Methods of treating animals suffering from diseases or disorders amenable to therapeutic intervention by modulating the expression of one or more JNK proteins with such oligonucleotide are also provided. Methods for the treatment and diagnosis of diseases or disorders associated with aberrant expression of one or more JNK proteins are also provided. Methods for inducing apoptosis and for treating diseases or conditions associated with a reduction in apoptosis are also provided.

Abstract: The present invention relates to a novel protein isolated from the leukocyte of IgA nephropathy patients, and DNA encoding the protein. It also relates to an oligonucleotide based on the nucleotide sequence complementary with the DNA, an antibody which specifically reacts with the protein and, furthermore, diagnostic and therapeutic drugs of IgA nephropathy comprising it.

Abstract: Antisense compositions targeted against an mRNA sequence coding for a selected protein, at a region having its 5′ end from 1 to about 25 base pairs downstream of a normal splice acceptor junction in the preprocessed mRNA, are disclosed. The antisense compound is RNase-inactive, and is preferably a phosphorodiamidate-linked morpholino oligonucleotide. Such targeting is effective to inhibit natural mRNA splice processing, produce splice variant mRNAs, and inhibit normal expression of the protein.

Abstract: As an effective therapy for proliferative skin and eye diseases such as psoriasis and proliferative diabetic retinopathy, this invention provides ribozymes and ribozyme delivery systems which cleave RNA encoding cytokines involved in inflammation, matrix metalloproteinases, a cyclin, a cell-cycle dependent kinase, a growth factor, or a reductase.

Abstract: The present invention relates to compositions and methods which enhance the local and systemic uptake and delivery of oligonucleotides and nucleic acids via non-parenteral routes of administration. Pharmaceutical compositions comprising oligonucleotides disclosed herein include, for systemic delivery, emulsion and microemulsion formulations for a variety of applications and oral dosage formulations. It has also surprisingly been discovered that oligonucleotides may be locally delivered to colonic sites by rectal enemas and suppositories in simple solutions, e.g., neat or in saline. Such pharmaceutical compositions of oligonucleotides may further include one or more penetration enhancers for the transport of oligonucleotides and other nucleic acids across mucosal membranes.

Abstract: Antisense compounds, compositions and methods are provided for modulating the expression of PTPN12. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding PTPN12. Methods of using these compounds for modulation of PTPN12 expression and for treatment of diseases associated with expression of PTPN12 are provided.

Abstract: A ribozyme comprising the following base sequence (I) or (II): base sequence (I)(SEQ ID No. 1): 5′-ACCGUUGGUUUCCGUAGUGUAGU GGUUAUCACGUUCGCCUAACACGCGAAAGGUCCCCGGUUCGAAACCGGGCACU ACAAACACAACACUGAUGAGGACCGAAAGGUCCGAAACGGGCACGUCGGAAACG GUUUU[[U]]-3′ base sequence (II)(SEQ ID No. 2): 5′-ACCGUUGGUUUCCGUAGUGUAGUGG UUAUCACGUUCGCCUAACACGCGAAAGGUCCCCGGUUCGAAACCGGGCACUACAAA CCAACACACAACACUGAUGAGGACCGAAAGGUCCGAAACGGGCACGUCGGAAACGG UUUU[[U]]-3′.

Abstract: Antisense compounds, compositions and methods are provided for modulating the expression of vascular endothelial growth factor receptor-2. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding vascular endothelial growth factor receptor-2. Methods of using these compounds for modulation of vascular endothelial growth factor receptor-2 expression and for treatment of diseases associated with expression of vascular endothelial growth factor receptor-2 are provided.

Abstract: The present invention provides a method for production of functional proteins including hormones by renal cells in a three dimensional co-culture process responsive to shear stress using a rotating wall vessel. Natural mixture of renal cells expresses the enzyme 1-a-hydroxylase which can be used to generate the active form of vitamin D: 1,25-diOH vitamin D3. The fibroblast cultures and co-culture of renal cortical cells express the gene for erythropoietin and secrete erythropoietin into the culture supernatant. Other shear stress response genes are also modulated by shear stress, such as toxin receptors megalin and cubulin (gp280). Also provided is a method of treating in-need individual with the functional proteins produced in a three dimensional co-culture process responsive to shear stress using a rotating wall vessel.

Abstract: The invention provides an isolated and purified DNA set forth as SEQ ID NO:15 in the Sequence Listing and an antisense oligonucleotide complementary to the DNA. The DNA represents the splicing enhancer sequence (SES) in exon 45 of human dystrophin gene, and serves as a template in preparation of the antisense oligonucleotide, which is used to induce exon 45 skipping in certain group of patient with Duchenne muscular dystrophy to restore the reading frame of dystrophin mRNA.

Abstract: The invention relates to a specific modified oligonucleotide complementary to a section of the human Ha-ras gene and mRNA, and its use to specifically regulate, modulate or inhibit expression of the HA-ras gene, and its use as a pharmaceutical for the treatment of conditions arising from the abnormal expression of the Ha-Ras gene, in particular in combination with chemotherapy and radiotherapy.

Abstract: The present invention describes methods of producing milligram quantities of three forms of purified Stat1 protein from recombinant DNA constructs. In addition, the Stat proteins may be isolated in their phosphorylated or nonphosphorylated forms (Tyr 701). The proteins can be produced in baculovirus infected insect cells, or E. coli. A compact domain in the amino terminus of Stat1&agr; was isolated and found to enhance DNA binding due to its ability to interact with a neighboring Stat protein. A relatively protease-resistant recombinant truncated form of the Stat protein was isolated in 40-50 mg quantities. Purification of the Stat proteins were performed after modifying specific cysteine residues of the Stat proteins to prevent aggregation. Activated EGF-receptor partially purified from membranes by immunoprecipitation was shown to be capable of in vitro catalysis of the phosphorylation of the tyrosine residue of Stat 1 known to be phosphorylated in vivo.

Abstract: Antisense compounds, compositions and methods are provided for modulating the expression of EDG1. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding EDG1. Methods of using these compounds for modulation of EDG1 expression and for treatment of diseases associated with expression of EDG1 are provided.

Abstract: Antisense compounds, compositions and methods are provided for modulating the expression of mucin 1, transmembrane. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding mucin 1, transmembrane. Methods of using these compounds for modulation of mucin 1, transmembrane expression and for treatment of diseases associated with expression of mucin 1, transmembrane are provided.

Abstract: Growth differentiation factor-6 (GDF-6) is disclosed along with its polynucleotide sequence and amino acid sequence. Also disclosed are diagnostic and therapeutic methods of using the GDF-6 polypeptide and polynucleotide sequences.

Abstract: Nucleozymes containing ribonucleotides and deoxyribonucleotides or nucleic acid analogues are described herein. The nucleozymes have catalytic activity and are significantly more resistant to degradation than their all-RNA ribozyme counterparts. Also described are methods for preparing the nucleozymes along with methods of using nucleozymes, e.g., as therapeutic agents.

Abstract: The present invention relates to methods and compositions for the detection, diagnosis, prevention and treatment of a disease, specifically cardiac, kidney or inflammatory disease, and related disorders. The present invention also relates to compositions and methods useful in the diagnosis, prevention and therapeutic treatment of a disease, specifically cardiac, kidney or inflammatory disease. Specifically, methods and compositions are provided for the diagnostic evaluation and prognosis of conditions involving a disease, specifically cardiac, kidney or inflammatory disease, for the identification of subjects exhibiting a predisposition to such conditions, for modulating the effect of these differentially expressed genes, for monitoring patients undergoing clinical evaluation for the prevention and treatment of a disease, specifically cardiac, kidney or inflammatory disease, and its disorders, and for monitoring the efficacy of compounds used in clinical trials.

Abstract: Antisense compounds, compositions and methods are provided for modulating the expression of vascular endothelial growth factor receptor-1. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding vascular endothelial growth factor receptor-1. Methods of using these compounds for modulation of vascular endothelial growth factor receptor-1 expression and for treatment of diseases associated with expression of vascular endothelial growth factor receptor-1 are provided.