Abstract: The invention is directed to a chimeric antigen receptor (CAR) directed against CD19, which comprises an amino acid sequence of any one of SEQ ID NO: 1-SEQ ID NO: 13. The invention also provides T-cells expressing the CAR and methods for destroying malignant B-cells.

Abstract: Embodiments of the present invention relate to compositions and methods for producing recombinant VSV viruses. In accordance with these embodiments, viral vectors can include a glycoprotein GP of the lymphocyte choriomeningitis virus (LCMV) instead of the G protein of the VSV. Other embodiments relate to cells for producing a LCMV-GP-pseudotyped VSV vectors. Embodiments also relate to the use of the vectors and cells as part of a pharmaceutical composition for the treatment of solid tumors.

Abstract: Described herein are capsid proteins and adeno-associated viruses capable of targeting various types of ocular cells including bipolar and horizontal cells. Also described herein are methods of treating various ocular disorders in a subject in need thereof by administering to the subject an effective concentration of a composition comprising the recombinant adeno-associated virus (AAV) of the invention.

Abstract: The present invention provides nucleic acids, vectors, host cells, methods and compositions to confer and/or augment immune responses mediated by cellular immunotherapy, such as by adoptively transferring CD8+ central memory T cells or combinations of central memory T cells with CD4+ T cells that are genetically modified to express a chimeric receptor under the control of an inducible promoter. In some alternatives the genetically modified host cell comprises a nucleic acid comprising a polynucleotide coding for a chimeric antigen receptor comprising a ligand binding domain, a polynucleotide comprising a spacer region, a polynucleotide comprising a transmembrane domain, and a polynucleotide comprising an intracellular signaling domain under the control of a drug inducible promoter. Controlling the expression of the chimeric receptor provides for the ability to turn expression on and off depending on the status of the patient.

Abstract: A method of transforming human cells into mechanosensory hair cells (MHCs), such as inner hear hair cells in the cochlea and vestibular organs, can include: causing human Wharton's jelly cells (hWJCs) to increase expression of or biological function of HATH1 so as to transform the hWJCs into MHCs. The method can include; administering a nucleic acid that encodes HATH1 to the hWJCs; causing inhibited expression of or biological function of HES1 and/or HES5 in the hWJCs; administering a nucleic acid that inhibits HES1 and/or a nucleic acid that inhibits HES5 to the hWJCs; causing inhibited expression of or biological function of HES1 and/or HES5 in the WJCs by administering a nucleic acid that inhibits HES1 and/or a nucleic acid that inhibits HES5; nucleic acids are administered includes a sequence of SEQ ID NO: 2, SEQ ID NO: 3, and/or SEQ ID NO: 4.

Abstract: A synthetic, flexible tissue matrix and methods for repairing hyaline cartilage defects in a joint using the flexible tissue matrix are described. The flexible tissue matrix includes a high molecular weight polycaprolactone polymer entangled with a polysaccharide such as hyaluronic acid. In the methods, autologous bone mesenchymal stem cells are introduced to a joint by a microfracturing technique, and a membrane made of the flexible matrix is applied to the joint. Cartilage which forms in the joint is hyaline cartilage rather than fibrocartilage.

Abstract: The present invention relates to a method to engineer immune cell for immunotherapy. In particular said immune cells are engineered with chimeric antigen receptors, which be activated by the combination of hypoxia and ligand extracellular binding as input signals. The invention also relates to new designed chimeric antigen receptors which are able to redirect immune cell specificity and reactivity toward a selected target exploiting the ligand-binding domain properties and the hypoxia condition. The present invention also relates to cells obtained by the present method, in particular T-cells, comprising said chimeric antigen receptors for use in cancer treatments.

Abstract: Disclosed herein are compositions and methods for treating cancer in a subject. This involves administering an oncolytic virus containing a heterologous DNA sequence encoding one or more immunomodulatory and/or immunostimulatory polypeptide(s) of interest to the subject under conditions effective to enhance an anti-tumor immune response in the subject, and to treat cancer. It also relates to a method of enhancing the delivery to and distribution within a tumor mass of therapeutic viruses.

Abstract: This invention provides WT1 peptides and methods of treating, reducing the incidence of, and inducing immune responses against a WT1-expressing cancer, comprising same.

Abstract: The present invention provides a method for inhibiting the RAS-ERK pathway by upregulation of RASA1 and SPRED1 mRNAs in tumor cells by anti-miR treatment. The method includes wherein an anti-miR-206 binds to a nucleotide comprising the sequence UAGCUUAUCAGACU (SEQ ID NO: 21), or to a nucleotide comprising the sequence UGGAAUGUAAGGAAGUGUGUGG (SEQ ID NO: 9). A method of re-expression of RAS-ERK pathway inhibitory proteins in triple negative cancer cells by administering to a patient having cancer an effective amount of an antagonist of KLF4-dependent microRNAs.

Abstract: The purpose of the present invention is to provide a colorectal cancer drug that uses microRNA exhibiting outstanding effectiveness in colorectal cancer patients, particularly colorectal cancer patients having a mutated KRAS gene. miR4689 and/or miR4685-3p can suppress the growth of colorectal cancer cells, particularly colorectal cancer cells having a mutated KRAS gene, and thus exhibit an effective antitumor effect.

Abstract: Compositions are provided comprising water-stable semi-conductor nanoplatelets encapsulated in a hydrophilic coating further comprising lipids and lipoproteins. Uses include biomolecular imaging and sensing, and methods of making comprise: colloidal synthesis of CdSe core NPLs; layer-by-layer growth of a CdS shell; and encapsulation of CdSe/CdScore/shell NPLs in lipid and lipoprotein components through an evaporation-encapsulation using zwitterionic phospholipids, detergents, and amphipathic membrane scaffold proteins.

Abstract: Viral vectors comprising engineered hOTC DNA and RNA sequences are provided which when delivered to a subject in need thereof are useful for treating hyperammonemia, ornithine transcarbamylase deficiency and symptoms associated therewith. Also provided are methods of using hOTC for treatment of liver fibrosis cirrhosis in OTCD patients by administering hOTC.

Abstract: An isolated promoter sequence comprising a nucleic acid of between 600 and 1700 nucleotides in length having at least 90% identity to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, or SEQ ID NO:7.

Abstract: Disclosed herein is a genetically-modified cell comprising in its genome a modified human T cell receptor alpha constant region gene, wherein the cell has reduced cell-surface expression of the endogenous T cell receptor. The present disclosure further relates to methods for producing such a genetically-modified cell, and to methods of using such a cell for treating a disease in a subject.

Abstract: Disclosed herein is a genetically-modified cell comprising in its genome a modified human T cell receptor alpha constant region gene, wherein the cell has reduced cell-surface expression of the endogenous T cell receptor. The present disclosure further relates to methods for producing such a genetically-modified cell, and to methods of using such a cell for treating a disease in a subject.

Abstract: Methods are disclosed for producing pancreatic beta cells in a subject. The methods include administering to the subject a vector encoding heterologous Pancreas duodenal homeobox protein (Pdx) 1 and MafA, wherein the vector does not encode Neurogenin 3 (Ngn3) and wherein the subject is not administered any other nucleic acid encoding Ngn3. The vector is administered intraductally into a pancreatic duct of the subject. Compositions are disclosed that include a) a viral vector comprising a promoter operably linked to a nucleic acids encoding Pdx1 and a nucleic acid encoding MafA, wherein the vector does not encode Ngn3; b) a buffer; and c) a contrast dye for endoscopic retrograde cholangiopancreatography. These compositions are of use in any of the methods disclosed herein.

Abstract: In alternative embodiments, provided are chimeric cells, which in alternative embodiments are the so-called “cardiochimeras”, and methods for making and using them. In alternative embodiments, exemplary chimeric cells as provided herein comprise a cardiac stem cell of cardiac origin or a cardiac progenitor cell fused to either a mesenchymal progenitor cell or mesenchymal stem cell, an endothelial progenitor cell or endothelial stem cell, or a cardiac stem cell or a cardiac progenitor cell. In alternative embodiments, the chimeric cells as provided herein comprise an endothelial progenitor cell, which may or may not be of cardiac origin, fused to either a mesenchymal progenitor cell or mesenchymal stem cell, an endothelial progenitor cell or endothelial stem cell, or a cardiac stem cell or a cardiac progenitor cell. In alternative embodiments, methods for making chimeric cells as provided herein further comprise selecting a cell fusion product comprising a viable chimera of the fused cells.

Abstract: Disclosed herein are recombinant viral vectors comprising a liver specific promotor in operable combination with a heterologous nucleic acid sequence encoding a protein, such as a clotting factor. Methods of treating a subject with a clotting disorder, such as hemophilia A or hemophilia B, are also provided.

Abstract: A method for analyzing water toxicity, the method including: exposure experiment, sample collection, transcriptome detection, metabolome detection, screening of differentially expressed genes, screening of differentially expressed metabolites, and identification of commonly changed biological pathways in both the transcriptome and the metabolome.