Abstract: The invention provides siRNA molecules for use in controlling pest infestation. The siRNA molecules target the mature mRNA of D. noxia cprr1-8 in a region between nucleotides 464 and 774 of SEQ ID NO: 23, or an equivalent region of an ortholog of D. noxia cprr1-8. Ingestion of the siRNA molecule by a pest inhibits the biological activity of the pest. In one embodiment, the siRNA molecule comprises a polynucleotide which has at least 80% sequence identity to the sequence 5? UAAACAAUCGCAAGAAGCUGA 3? (SEQ ID NO: 1) and a polynucleotide which has at least 80% sequence identity to the sequence 5? AGCUUCUUGCGAUUGUUUAAG 3? (SEQ ID NO: 2). Compositions comprising the siRNA molecules, vectors encoding the siRNA molecules, and methods for using the siRNA molecules are also provided.

Abstract: The invention relates to iRNA, e.g., double stranded ribonucleic acid (dsRNA), compositions targeting the complement factor C3 gene, and methods of using such iRNA, e.g., dsRNA, compositions to inhibit expression of a C3 gene and to treat subjects having a complement component C3-associated disease, e.g., paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), atypical hemolytic uremic syndrome (aHUS), neuromyelitis optica (NMO), multifocal motor neuropathy (MMN), myasthenia gravis (MG), and C3 glomerulonephritis.

Abstract: The present disclosure provides oligonucleotides and double-stranded RNAs (dsRNAs) targeting Hemipteran and Lepidopteran insect pests. Bantam-sequence targets are detailed and shown to be effective targets for RNAi induction utilizing multiple dsRNAs, antisense oligonucleotides, and modified dsRNAs (e.g., 2?-O-methylated and dsRNAs containing non-canonical nucleosides).

Abstract: The present invention relates to antisense oligonucleotides that are capable of modulating expression of Tau in a target cell. The oligonucleotides hybridize to MAPT mRNA. The present invention further relates to conjugates of the oligonucleotide and pharmaceutical compositions and methods for treatment of Tauopathies, Alzheimzer's disease, fronto-temporal dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticobasal ganglionic degeneration (CBD), epilepsy, Dravet syndrome, depression, seizure disorders and movement disorders.

Abstract: Provided are compounds, methods, and pharmaceutical compositions for reducing the amount or activity of PLP1 RNA in a cell or subject, and in certain instances reducing the amount of proteolipid protein 1 in a cell or subject. Such compounds, methods, and pharmaceutical compositions are useful to ameliorate at least one symptom or hallmark of a leukodystrophy. Such symptoms and hallmarks include hypotonia, nystagmus, optic atrophy, respiratory distress, motor delays, cognitive dysfunction, speech dysfunction, spasticity, ataxia, seizures, choreiform movements, and death. Such leukodystrophies include Pelizaeus-Merzbacher disease.

Abstract: An object of the present invention is to provide a therapeutic agent for hereditary spastic paraplegia (HSP) SPG4. Specifically, the present invention relates to a composition for preventing or treating a neurodegenerative disease such as hereditary spastic paraplegia SPG4, the composition comprising, as an active ingredient, a substance that inhibits a function of miR-33a.