Abstract: Provided are compounds, methods, and pharmaceutical compositions for reducing the amount or activity of APP RNA in a cell or animal, and in certain instances reducing the amount of APP protein in a cell or animal. Such compounds, methods, and pharmaceutical compositions are useful to ameliorate at least one symptom or hallmark of a neurodegenerative disease or disorder. Such symptoms and hallmarks include cognitive impairment, including a decline in memory and language skills, behavioral and psychological symptoms such as apathy and lack of motivation, gait disturbances and seizures, progressive dementia, and abnormal amyloid deposits.

Abstract: Products, compositions, and their uses are provided. In particular, nucleic acid products that modulate, in particular interfere with or inhibit, Factor XI (FXI) gene expression are provided. The products can be oligomeric compounds that comprise at least a first region of linked nucleosides having at least a first nucleobase sequence that is at least partially complementary to at least a portion of RNA transcribed from an FXI gene, wherein said first nucleobase sequence is selected from the following sequences, or a portion thereof: SEQ ID NOs 1 to 250.

Abstract: Provided herein are oligonucleotide compositions that inhibit ANGPTL7 and reduce intraocular pressure when administered to an eye. The oligonucleotide compositions contain nucleoside modifications.

Abstract: The invention relates to editing oligonucleotides (EONs) that carry stereospecific phosphorothioate internucleotide linkage modifications at specified positions and that do not carry such modifications on positions that would lower RNA editing efficiency. The selection of positions that should or should not carry a phosphorothioate Rp and/or Sp configuration modification is based on computational modelling that revealed incompatibilities of the stereospecific linkages with the intermolecular oxygen-mediated hydrogen bond network.

Abstract: Embodiments of the disclosure include methods and compositions in which two inter-chromosomal or intra-chromosomal genomic DNA regions are rearranged upon exposure of the genomic DNA to a chimeric RNA that produces fusion of the two regions. The chimeric RNA hybridizes to the two different parts of the genomic DNA and forms a DNA/RNA hybrid in a sequence-specific manner, thereby facilitating genomic rearrangement. In particular embodiments this mechanism is utilized to produce directed gene fusion in targeted genomic DNA regions.

Abstract: One aspect of the present invention relates to double-stranded RNA (dsRNA) agent capable of inhibiting the expression of a target gene. Other aspects of the invention relate to pharmaceutical compositions comprising these dsRNA molecules suitable for therapeutic use, and methods of inhibiting the expression of a target gene by administering these dsRNA molecules, e.g., for the treatment of various disease conditions.

Abstract: The present invention relates to oligonucleotides which alter the splicing pattern of progranulin in cells, and their use in the treatment of neurological disorders.

Abstract: Oligonucleotides and compositions including the same are disclosed for inhibiting or reducing patatin-like phospholipase domain-containing protein 3 (PNPLA3) gene expression. Methods of making and using the oligonucleotides also are disclosed, particularly uses relating to treating diseases, disorders and/or conditions associated with PNPLA3 expression.

Abstract: The present invention relates to methods and compositions comprising an inhibitor of KLF11 signaling for treatment of gastrointestinal motility disorders, obesity and diabetes.

Abstract: A composition of drug targets and the method of using thereof. The composition comprises a vector and a drug using FKBP10 and PCOLCE genes and/or the encoded proteins thereof as drug targets.

Abstract: The invention provides siRNA molecules for use in controlling pest infestation. The siRNA molecules target the mature mRNA of D. noxia cprr1-8 in a region between nucleotides 464 and 774 of SEQ ID NO: 23, or an equivalent region of an ortholog of D. noxia cprr1-8. Ingestion of the siRNA molecule by a pest inhibits the biological activity of the pest. In one embodiment, the siRNA molecule comprises a polynucleotide which has at least 80% sequence identity to the sequence 5? UAAACAAUCGCAAGAAGCUGA 3? (SEQ ID NO: 1) and a polynucleotide which has at least 80% sequence identity to the sequence 5? AGCUUCUUGCGAUUGUUUAAG 3? (SEQ ID NO: 2). Compositions comprising the siRNA molecules, vectors encoding the siRNA molecules, and methods for using the siRNA molecules are also provided.

Abstract: The invention relates to iRNA, e.g., double stranded ribonucleic acid (dsRNA), compositions targeting the complement factor C3 gene, and methods of using such iRNA, e.g., dsRNA, compositions to inhibit expression of a C3 gene and to treat subjects having a complement component C3-associated disease, e.g., paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), atypical hemolytic uremic syndrome (aHUS), neuromyelitis optica (NMO), multifocal motor neuropathy (MMN), myasthenia gravis (MG), and C3 glomerulonephritis.

Abstract: The present disclosure provides oligonucleotides and double-stranded RNAs (dsRNAs) targeting Hemipteran and Lepidopteran insect pests. Bantam-sequence targets are detailed and shown to be effective targets for RNAi induction utilizing multiple dsRNAs, antisense oligonucleotides, and modified dsRNAs (e.g., 2?-O-methylated and dsRNAs containing non-canonical nucleosides).

Abstract: The present invention relates to antisense oligonucleotides that are capable of modulating expression of Tau in a target cell. The oligonucleotides hybridize to MAPT mRNA. The present invention further relates to conjugates of the oligonucleotide and pharmaceutical compositions and methods for treatment of Tauopathies, Alzheimzer's disease, fronto-temporal dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticobasal ganglionic degeneration (CBD), epilepsy, Dravet syndrome, depression, seizure disorders and movement disorders.

Abstract: Provided are compounds, methods, and pharmaceutical compositions for reducing the amount or activity of PLP1 RNA in a cell or subject, and in certain instances reducing the amount of proteolipid protein 1 in a cell or subject. Such compounds, methods, and pharmaceutical compositions are useful to ameliorate at least one symptom or hallmark of a leukodystrophy. Such symptoms and hallmarks include hypotonia, nystagmus, optic atrophy, respiratory distress, motor delays, cognitive dysfunction, speech dysfunction, spasticity, ataxia, seizures, choreiform movements, and death. Such leukodystrophies include Pelizaeus-Merzbacher disease.

Abstract: An object of the present invention is to provide a therapeutic agent for hereditary spastic paraplegia (HSP) SPG4. Specifically, the present invention relates to a composition for preventing or treating a neurodegenerative disease such as hereditary spastic paraplegia SPG4, the composition comprising, as an active ingredient, a substance that inhibits a function of miR-33a.