Abstract: A transkingdom platform for the delivery of therapeutic nucleic acids to epithelial tissues where the nucleic acids are designed to have enhanced stability. The platform offers numerous improvements to prior delivery platforms including expression of the double-stranded RNA binding domain (dsRBD) domains of TAR RNA binding protein (TRBP), knockout of RNase R activity in the bacterial delivery vehicle, and expression of the methyltransferase gene, HEN1, for simultaneous packaging with a therapeutic nucleic acid delivery vehicle.

Abstract: A miR-1983 inhibitor comprising an anti-miR-1983 oligonucleotide that is complementary to at least part of CTCACCTGGAGCATGTTTTCT (SEQ ID NO: 1), the part comprising at least nucleotides 2 to 8 of CTCACCTGGAGCATGTTTTCT (SEQ ID NO: 1).

Abstract: The invention provides for recombinant AAV vectors comprising a polynucleotide sequence comprising the guide strand of miR-29c and methods of using the recombinant vectors to reduce or prevent fibrosis in subjects suffering from muscular dystrophy.

Abstract: The invention relates to method for repairing aberrant; splicing, wherein such aberrant: splicing is caused by the presence of a natural pseudo exon, comprising blocking of either the natural cryptic 3? splice site or the natural cryptic 5? splice site of said natural pseudo exon with an antisense oligomeric compound (AON). Further, the invention comprises an antisense oligomeric compound targeting SEQ ID NO: 1 or SEQ ID NO: 171, preferably selected from the sequences of SEQ ID NO: 267-2040, sequences that are complementary to said sequences or sequences that have an identity of 80% with said sequences or the complementary sequences. The invention further envisages the use of two antisense oligomeric compounds, a first AON targeting SEQ ID NO: 1 and a second targeting AON or SEQ ID NO: 171. These AONs are specifically for use in the treatment of Pompe disease. It is an aspect of the invention that antisense therapy using the above AONs or combinations thereof is used in combination with ERT.

Abstract: The present invention relates to antisense oligonucleotides that are capable of modulating expression of Tau in a target cell. The oligonucleotides hybridize to MAPT mRNA. The present invention further relates to conjugates of the oligonucleotide and pharmaceutical compositions and methods for treatment of Tauopathies, Alzheimzer's disease, fronto-temporal dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticobasal ganglionic degeneration (CBD), epilepsy, Dravet syndrome, depression, seizure disorders and movement disorders.

Abstract: The present embodiments provide methods, compounds, and compositions useful for inhibiting MALAT1 expression, which may be useful for treating, preventing, or ameliorating a cancer associated with MALAT1.

Abstract: Methods for treating diseases and conditions mediated by the high affinity IgE receptor (Fc?RI). Antisense oligomers for modulating splicing of mRNA encoding the Fc?RI? protein, thereby down-regulating cell-surface expression of Fc?RI, and uses of the antisense oligomers for inhibiting mast cell degranulation, cytokine release, migration, and proliferation.

Abstract: A method of treating an inflammatory disorder in a subject, comprising administering to the subject in need thereof a nucleic acid molecule for inhibiting the expression of Hom-1. Specifically, the nucleic acid molecule is an RNAi agent or an antisense morpholino oligonucleotide. Further disclosed is a method of selecting a therapeutic for an inflammatory disorder in a subject, or monitoring the efficacy of a therapeutic for an inflammatory disorder in a subject, comprising detecting the expression level of Hom-1 in an inflamed tissue sample obtained from the subject.

Abstract: The present invention relates to anti-gene oligonucleotides adapted to hybridize to DNA in a HTT gene, which are based on locked nucleic acids, phosphorodiamidate morpholino oligomers, (PMO) or equivalent oligonucleotide analogues comprising a (CAG)n sequence, and whose target is a sequence where the majority of the repeats are CAG/CTG, for use in down regulating the expression of the HTT gene, resulting in reduced HTT mRNA and protein levels in afflicted subjects, or in diagnosis, treatment and/or prevention of Huntington's disease, and where the anti-gene oligonucleotides target non-canonical DNA structures, including hairpin and cruciform. The invention also relates to a delivery system comprising said oligonucleotides and said use thereof.

Abstract: Disclosed herein are compounds and methods for modulating C9orf72 transcript. Such compounds and methods are useful to treat, prevent, or ameliorate neurodegenerative diseases in an individual in need thereof.

Abstract: Provided are compounds, methods, and pharmaceutical compositions for reducing the amount or activity of UBE3A-ATS, the endogenous antisense transcript of ubiquitin protein ligase E3A (UBE3A) in a cell or subject, and in certain instances increasing the expression of paternal UBE3A and the amount of UBE3A protein in a cell or subject. Such compounds, methods, and pharmaceutical compositions are useful to ameliorate at least one symptom or hallmark of a neurogenetic disorder. Such symptoms and hallmarks include developmental delays, ataxia, speech impairment, sleep problems, seizures, and EEG abnormalities. Such neurogenetic disorders include Angelman Syndrome.

Abstract: Disclosed herein are polynucleic acid molecules, pharmaceutical compositions, and methods for treating muscle atrophy or myotonic dystrophy.

Abstract: Disclosed herein are polynucleic acid molecules, pharmaceutical compositions, and methods for treating muscle atrophy or myotonic dystrophy.

Abstract: Disclosed herein are improved PNA based monomers, nucleobases, oligomers and probes for use in a variety of different methods of analysing nucleic acids. Further, the disclosure provides methods of preparing the modified and improved PNA molecules as well as methods of using the same.

Abstract: Provided are immunostimulatory bacteria and oncolytic viruses, and pharmaceutical compositions containing the bacteria and/or viruses, that act as three prime repair exonuclease 1 (TREX1) antagonists. The bacteria and viruses are for treating tumors that are human papillomavirus (HPV) positive or that have a high tumor mutational burden (TMB). The immunostimulatory bacteria and oncolytic viruses encode therapeutic products such RNAi, such as shRNA and microRNA, that mediate gene disruption and/or inhibit expression of TREX1, or that inhibit TREX1. The bacteria contain additional modifications to enhance their anti-tumor activity. The bacteria and viruses are used for treatment of tumors in which TREX1 expression correlates with the presence of the tumor or properties of the tumor, such that inhibition of TREX1 advantageously treats the tumor.

Abstract: Provided herein are, inter alia, compositions and methods for the treatment of hypercholesterolemia. The compositions include double-stranded and single-stranded RNAs capable of repressing IncRNA and concomitantly increasing LDLR activation. The compositions are useful for activating LDLR in liver cells.

Abstract: The present invention relates to the field of medicine. In particular, it relates to novel antisense oligonucleotides that may be used in the treatment, prevention and/or delay of Stargardt disease.

Abstract: This invention provides nanoparticles containing protein-polynucleotide complexes and methods of manufacture and methods of their use. These particles, when administered to a subject in need, are capable of delivering these complexes to target cells and target intracellular locations where they can perform a therapeutic function. In some embodiments, this therapeutic function includes gene editing, induction of gene skipping, and regulation of gene expression. The instant nanoparticles are generally formed by designing and synthesizing the polynucleotide to according to its intended function, combining it with a protein selected for its substrate specificity and enzymatic function in a manner to form a polynucleotide-protein complex, encapsulating the complexes by dispersion into a water-insoluble surfactant system, optionally adding a targeting ligand, and stabilizing the nanoparticles by crystallization of the ligand to the surface of the nanoparticles.

Abstract: The present invention provides compounds comprising oligonucleotides complementary to a pyruvate kinase M transcript. Certain such compounds are useful for hybridizing to a pyruvate kinase M transcript, including but not limited to a pyruvate kinase M transcript in a cell. In certain embodiments, such hybridization results in modulation of splicing of the pyruvate kinase M transcript. In certain embodiments, such compounds are used to treat one or more symptoms associated with cancer.

Abstract: Described herein are methods for treating fibrosis, e.g., kidney fibrosis, using agents that target Secreted Modular Calcium-binding protein 2 (SMOC2).