Abstract: Disclosed is a method for purifying Interleukin-10 (IL-10). The method is comprised of subjecting an IL-10 containing solution to cation exchange chromatography, anion exchange chromatography, hydroxyapatite chromatography, and gel filtration chromatography. The present invention is also comprised of a process for separating different IL-10 dimers present in a protein fraction from each other by subjecting the protein fraction to hydroxyapatite chromatography. The present invention is also comprised of a process for separating variants of a protein differing in an N-terminal amino acid sequence present in a protein fraction from each other by subjecting the protein fraction to hydroxyapatite chromatography.

Abstract: A mutant AOX2 promoter wherein 1 to 3 oligonucleotide(s) GATAGGCTATTTTTGTCGCATAAAT (SEQUENCE ID NO: 2) is (are) added in the normal direction, the reverse direction or in both the normal and reverse directions at the 5' end side of a partial DNA fragment of a wild-type AOX2 promoter, a vector carrying the promoter, a transformant into which the vector has been introduced and a method for producing a heterologous protein, comprising culture of the transformant. The mutant AOX2 promoter of the present invention has a markedly enforced promoter activity as compared with wild-type AOX2 promoters. Accordingly, the promoter of the present invention is highly utilizable as a promoter to be carried by a vector capable of expressing a heterologous protein. The vector of the present invention can efficiently express and produce various useful heterologous proteins in hosts.

Abstract: The present invention concerns DNA sequences comprising all or part of the K. lactis promoter gene PDC1 or a derivative thereof, and having transcriptional promoter activity. The invention also relates to the use of the sequences for the expression of recombinant genes.

Abstract: A method and apparatus for collecting a cell sample from a liquid specimen utilizes a collection receptacle in which the specimen is deposited, with a filter media being place in communication with a discharge port in the collection receptacle and a transfer device for drawing specimen from the collection receptacle and through the filter for capturing the cellular component of the specimen on the filter media for defining a cell sample for analysis. The collection receptacle, filter media and carrier therefor and the transfer device may be supplied in kit form for use in a clinical environment. A hypobaric vessel may be used and the transfer device and this vessel may also serve as a disposal receptacle for the liquid specimen passed through the filter media.