Abstract: Provided herein are methods for the collection and amplification of circulating nucleic acids from a non-celluar fraction of a biological sample. Circulating nucleic acids are extracted from the non-cellular fraction and are circularized to generate single-stranded nucleic acid circles, which are then subsequently amplified by rolling circular amplification using random primers to produce an amplified library. Devices for the collection of a non-cellular fraction from a biological sample are also provided. The device includes a filtration membrane and a dry solid matrix, which is in direct contact with the filtration membrane.

Abstract: The disclosure is directed to methods, kits, and compositions for amplifying and detecting a human immunodeficiency virus-1 (HIV-1) in a sample, which comprises a variety of combinations of forward oligonucleotide primers, reverse oligonucleotide primers, and oligonucleotide probes.

Abstract: According to one embodiment, a detection method is a method for detecting a plurality of target nucleic acids in a sample. The method includes (a) preparing a chain-elongation nucleic acid set group, a primer set, and a probe immobilized substrate, (b) obtaining the target nucleic acid and a long-chain nucleic acid group containing a first sub-chain-elongation nucleic acid and a second sub-chain-elongation nucleic acid, (c) obtaining an amplification product group by maintaining the long-chain nucleic acid group and the primer set under amplification conditions, (d) detecting presence/absence and/or an amount of hybridization, and (e) detecting the plurality of target nucleic acids.

Abstract: The present invention provides methods for analyzing large nucleic acids including chromosomes and chromosomal fragments. In one aspect, the present invention provides a method of nucleic acid analysis comprising the steps of (a) obtaining a sample of nucleic acid comprising at least one chromosome or fragment greater than about 1 000 base pairs in length and containing a target region; (b) creating an emulsion in which each drop of the emulsion contains an average of between about 0-2, 0-1.75, 0-1.5, 0-1.0, 0-0.75, 0-0.5, or fewer chromosomes or fragments of step (a), (c) performing emulsion PCR, (d) quantifying the number of emulsion droplets containing amplified nucleic acid from the target region; (e) calculating the ratio of droplets containing amplified nucleic acid from the target region to total droplets; and (f) comparing the ratio of step (e) to a reference ratio representing a known genotype.

Abstract: A thermal cycling method and associated device is described.

Abstract: Disclosed herein are methods for multiple stage isothermal amplification of nucleic acid comprising a first substantially isothermal amplification reaction on the nucleic acid to generate a first amplification product and at least one substantially isothermal amplification reaction on the first amplification product to generate at least one second amplification product in an amount sufficient for recovery, testing, or characterization.

Abstract: Next Generation DNA sequencing promises to revolutionize clinical medicine and basic research. However, while this technology has the capacity to generate hundreds of billions of nucleotides of DNA sequence in a single experiment, the error rate of approximately 1% results in hundreds of millions of sequencing mistakes. These scattered errors can be tolerated in some applications but become extremely problematic when “deep sequencing” genetically heterogeneous mixtures, such as tumors or mixed microbial populations. To overcome limitations in sequencing accuracy, a method Duplex Consensus Sequencing (DCS) is provided. This approach greatly reduces errors by independently tagging and sequencing each of the two strands of a DNA duplex. As the two strands are complementary, true mutations are found at the same position in both strands. In contrast, PCR or sequencing errors will result in errors in only one strand.

Abstract: The present disclosure provides fully integrated microfluidic systems to perform nucleic acid analysis. These processes include sample collection, nucleic acid extraction and purification, amplification, sequencing, and separation and detection. The present disclosure also provides optical detection systems and methods for separation and detection of biological molecules. In particular, the various aspects of the invention enable the simultaneous separation and detection of a plurality of biological molecules, typically fluorescent dye-labeled nucleic acids, within one or a plurality of microfluidic chambers or channels. The nucleic acids can be labeled with at least 6 dyes, each having a unique peak emission wavelength. The present systems and methods are particularly useful for DNA fragment sizing applications such as human identification by genetic fingerprinting and DNA sequencing applications such as clinical diagnostics.

Abstract: Disclosed herein is a system and method for increasing the fidelity of measured genetic data, for making allele calls, and for determining the state of aneuploidy, in one or a small set of cells, or from fragmentary DNA, where a limited quantity of genetic data is available. Poorly or incorrectly measured base pairs, missing alleles and missing regions are reconstructed using expected similarities between the target genome and the genome of genetically related individuals. In accordance with one embodiment, incomplete genetic data from an embryonic cell are reconstructed at a plurality of loci using the more complete genetic data from a larger sample of diploid cells from one or both parents, with or without haploid genetic data from one or both parents. In another embodiment, the chromosome copy number can be determined from the measured genetic data, with or without genetic information from one or both parents.

Abstract: The present invention refers to a method for isolating a fraction enriched of small RNA molecules from a fungal or plant sample.

Abstract: The invention provides methods for simultaneously amplifying multiple nucleic acid regions of interest in one reaction volume as well as methods for selecting a library of primers for use in such amplification methods. The invention also provides library of primers with desirable characteristics, such as minimal formation of amplified primer dimers or other non-target amplicons.

Abstract: A method for amplifying and detecting microorganisms, such as species of Listeria, is described. The method utilizes gene-matched enrichment media and PCR-based detection. The enrichment media is spent media produced using a modified microorganism containing a plurality of mutations in a selected gene such that the modified microorganism does not contain the PCR signature. Thus, PCR detects only the amplified microorganism of interest, not the modified microorganism. Exemplary methods and kits for amplification and detection of Listeria species are described.

Abstract: Methods and compositions for detecting genetic instability using digital amplification assays. The methods may be performed in a set of isolated volumes and generally may involve competitive hybridization of a competitor and a probe/primer with a normal allele and one or more mutant alleles of a microsatellite locus. The competitor may be configured to compete similarly with, or to outcompete, the primer/probe for hybridization with the normal allele. The primer/probe may be configured to outcompete the competitor for hybridization with various mutant alleles of the locus that alter the length of the repetitive sequence by different amounts. Isolated volumes in which the primer/probe outcompetes the competitor may be enumerated, and represent one or more of the mutant alleles. The methods may enable diagnosing microsatellite instability and treating a subject based on the diagnosis.

Abstract: The invention provides methods for simultaneously amplifying multiple nucleic acid regions of interest in one reaction volume as well as methods for selecting a library of primers for use in such amplification methods. The invention also provides library of primers with desirable characteristics, such as minimal formation of amplified primer dimers or other non-target amplicons.

Abstract: The invention provides are agent and a method using this reagent for the detection of porcine adenovirus in a sample. The reagent comprises the following primer pair: the upstream primer: (5?-3?) ATCTTGAAATCACAATTCTTCTG (SEQ ID NO: 1); the downstream primer: (5?-3?) CAAGGAGCAGYTGGTGGAG (SEQ ID NO: 2), among the downstream primer Y can be T or C. This reagent and method are of strong specificity and high sensitivity, which can rapidly detect pig porcine adenovirus in samples.

Abstract: The invention provides methods for simultaneously amplifying multiple nucleic acid regions of interest in one reaction volume as well as methods for selecting a library of primers for use in such amplification methods. The invention also provides library of primers with desirable characteristics, such as minimal formation of amplified primer dimers or other non-target amplicons.

Abstract: The invention provides methods for simultaneously amplifying multiple nucleic acid regions of interest in one reaction volume as well as methods for selecting a library of primers for use in such amplification methods. The invention also provides library of primers with desirable characteristics, such as minimal formation of amplified primer dimers or other non-target amplicons.

Abstract: Provided herein are compositions, methods, and kits for enriching for one or more nucleic acid sequences of interest in a sample. The methods include providing a circular ligase, one or more 5? hook probes and/or one or more 3? hook probes and contacting the sample comprising the nucleic acids with the circular ligase and one or more 5? hook probes and/or one or more 3? hook probes under conditions to allow the hook probes to selectively bind to the one or more nucleic acid sequences of interest, and under conditions to form one or more hook products, each hook product comprising the hook probes and the one or more nucleic acid sequences of interest.

Abstract: A method for determining the presence or absence of a member of a group of bacterial organisms in a sample, wherein the method comprises determining whether a target region of the smpB gene is present in said sample is provided. Primers, probes and kits for use in these methods also form part of the invention, as does the use of an smpB gene target region to detect the presence or absence of a member of a group of bacterial organisms in a sample, in a range of clinical and non-clinical applications.

Abstract: The present invention pertains to an in vitro method in which the frequency of the targeted nucleotide sequence containing the DNA fragment of interest is increased stepwise, by several rounds of 1) dilution of a sample containing the DNA fragment of interest into several replicates (separation), 2) randomly amplifying DNA in the replicates (concentration), 3) detecting the DNA fragment of interest in at least one of the diluted and amplified replicates (selection) and repeating steps 1) through 3) until the DNA fragment of interest can be sequenced by standard sequencing techniques.