Abstract: A method to predict an increased risk of a greater susceptibility to a metal implant sensitivity in a test person. The method includes providing an isolated sample with a genetic material of the test person, and examining a single nucleotide polymorphism rs1143627 SEQ?ID?NO:?1 AGCCTCCTACTTCTGCTTTTGAAAGC[C/T]ATAAAA ACAGCGAGGGAGAACTGG,? in a gene coding for interleukin 1 beta and ascertaining whether a C is present at a position of the single nucleotide polymorphism, and/or examining a VNTR polymorphism rs2234663 with the repeat SEQ?ID?NO:?2 ATCCTGGGGAAAGTGAGGGAAATATGGACATCACATGGAACAACAT CCAGGAGACTCAGGCCTCTAGGAGTAACTGGGTAGTGTGC, in a gene coding for a IL1 receptor antagonist, IL1-RN and ascertaining whether the repeat is present five times.

Abstract: Provided herein are novel organoid culture media, organoid culture systems, and methods of culturing tumor organoids using the subject organoid culture media. Also provided herein are tumor organoids developed using such organoid culture systems, methods for assessing the clonal diversity of the tumor organoids, and methods for using such tumor organoids, for example, for tumor modelling and drug development applications. In particular embodiments, the tumor organoid culture media provided herein is substantially free of R-spondins (e.g., R-spondin1).

Abstract: This document provides methods and materials related to genetic variations of developmental disorders. For example, this document provides methods for using such genetic variations to assess susceptibility of developing Autism Spectrum Disorder.

Abstract: The present disclosure provides methods, systems, compositions, and kits for the high-throughput detection of multi-molecule biomarkers in a biological sample. The disclosed methods, systems, compositions, and kits utilize antibody-oligonucleotide tags to detect two or more molecules that are in close proximity.

Abstract: The invention provides a gene signature for use in determining a likelihood of a latent tuberculosis (TB) infection in a subject transitioning to active TB disease. The gene signature comprises at least SEPT4 and BLK, and optionally also GAS6 and/or CD1C. Expression levels of these genes are detected in a sample from the subject, and the ratios of expression of at least two of the above genes are calculated (e.g. SEPT4:BLK, SEPT4:CD1C, GAS6:BLK and/or GAS6:CD1C). A score is assigned to each ratio, the score being indicative of the likelihood of the latent TB infection transitioning into active TB disease, based on the ratio for the respective gene pair. The subject can be identified as having a latent TB infection that is likely to transition into active TB disease or that is not likely to transition into active TB disease based on the score or on the average of the scores.

Abstract: Compositions and methods for the detection and treatment of ADHD are provided.

Abstract: Methods for predicting the development of sepsis in a subject at risk for developing sepsis are provided. In one method, features in a biomarker profile of the subject are evaluated. The subject is likely to develop sepsis if these features satisfy a particular value set. Methods for predicting the development of a stage of sepsis in a subject at risk for developing a stage of sepsis are provided. In one method, a plurality of features in a biomarker profile of the subject is evaluated. The subject is likely to have the stage of sepsis if these feature values satisfy a particular value set. Methods of diagnosing sepsis in a subject are provided. In one such method, a plurality of features in a biomarker profile of the subject is evaluated. The subject is likely to develop sepsis when the plurality of features satisfies a particular value set.

Abstract: It is intended to provide a kit or a device for the detection of esophageal cancer and a method for detecting esophageal cancer. The present invention provides a kit or a device for the detection of esophageal cancer, comprising nucleic acid(s) capable of specifically binding to miRNA(s) in a sample f a subject, and a method for detecting esophageal cancer, comprising measuring the miRNA in vitro.

Abstract: The present invention is directed to methods and kits for determining the presence of a mutated SLC30A2 polynucleotide. The invention is further directed to methods of determining a subject's genetic-susceptibility to zinc deficiency and evaluating zinc levels in a composition comprising breast milk.

Abstract: It is intended to provide a kit or a device for the detection of lung cancer and a method for detecting lung cancer. The present invention provides a kit or a device for the detection of lung cancer, comprising a nucleic acid capable of specifically binding to a miRNA in a sample from a subject, and a method for detecting lung cancer, comprising measuring the miRNA in vitro.

Abstract: An object of the present invention is to provide a kit or a device for the detection of prostate cancer and a method for detecting prostate cancer. The present invention provides a kit or a device for the detection of prostate cancer, comprising a nucleic acid capable of specifically binding to a miRNA in a sample of a subject, and a method for detecting prostate cancer, comprising measuring the miRNA in vitro.

Abstract: It is intended to provide a kit or device for the detection of liver cancer and a method for detecting liver cancer. The present invention relates to a kit or device for the detection of liver cancer, comprising a nucleic acid capable of specifically binding to miRNA in a sample of a subject, and a method for detecting liver cancer, comprising measuring the miRNA in vitro.

Abstract: The present invention provides a kit or device for the detection of biliary tract cancer, and a method for detecting biliary tract cancer. The present invention relates to a kit or device for the detection of biliary tract cancer, comprising a nucleic acid capable of specifically binding to miRNA in a sample of a subject, and a method for detecting biliary tract cancer, comprising measuring the miRNA in vitro.

Abstract: This invention relates to a kit or a device for the detection of stomach cancer and a method for detecting stomach cancer, and provides a kit or a device for the detection of stomach cancer, comprising a nucleic acid(s) capable of specifically binding to a miRNA(s) in a sample from a subject, and a method for detecting stomach cancer, comprising measuring the miRNA(s) in vitro.

Abstract: Disclosed herein is a combination of genomic sequences whose methylation patterns have utility for the improved detection and differentiation between colorectal neoplasms. Further disclosed herein are methods, nucleic acids and kits for detecting or differentiating between colorectal neoplasms.

Abstract: It is intended to provide a kit or a device for the detection of breast cancer and a method for detecting breast cancer. The present invention provides a kit or a device for the detection of breast cancer, comprising nucleic acid(s) capable of specifically binding to a miRNA in a sample of a subject, and a method for detecting breast cancer, comprising measuring the miRNA in vitro.

Abstract: It is intended to provide a kit or a device for the detection of colorectal cancer and a method for detecting colorectal cancer. The present invention provides a kit or a device for the detection of colorectal cancer, comprising a nucleic acid capable of specifically binding to a miRNA in a sample from a subject, and a method for detecting colorectal cancer, comprising measuring the miRNA in vitro.

Abstract: The present invention relates to the proline rich transmembrane protein 2 (PRRT2) gene, and the identification of mutations and variations in PRRT2 that give rise to seizure and movement disorders. Accordingly, the present invention provides methods for the diagnosis or prognosis of such disorders by identifying alterations in the PRRT2 gene. Identification of alterations in the PRRT2 gene also enables the identification of subjects with an increased likelihood of having an offspring predisposed to such disorders. The present invention also provides an isolated nucleic acid molecule comprising an alteration in the PRRT2 gene, wherein said alteration produces a seizure and/or movement disorder phenotype. Also provided is an isolated PRRT2 polypeptide that comprises an alteration which produces a seizure and/or movement disorder phenotype.

Abstract: Provided are methods for detecting or diagnosing a traumatic brain injury or TBI by detecting concentration levels miRNAs associated with TBI in saliva. Methods for controlled and normalized comparisons of salivary miRNA concentration levels are further provided. Assay kits comprising salivary miRNAs, probes and/or primers for detecting salivary miRNAs are also provided.

Abstract: The present invention relates to refined prognostic clinical tools, methods, and kits for the evaluation of risk and treatment of distant recurrence in ER+/HER2? breast cancer patients.