Patents Examined by Stephen T Kapushoc
  • Patent number: 11649501
    Abstract: A method to predict an increased risk of a greater susceptibility to a metal implant sensitivity in a test person. The method includes providing an isolated sample with a genetic material of the test person, and examining a single nucleotide polymorphism rs1143627 SEQ?ID?NO:?1 AGCCTCCTACTTCTGCTTTTGAAAGC[C/T]ATAAAA ACAGCGAGGGAGAACTGG,? in a gene coding for interleukin 1 beta and ascertaining whether a C is present at a position of the single nucleotide polymorphism, and/or examining a VNTR polymorphism rs2234663 with the repeat SEQ?ID?NO:?2 ATCCTGGGGAAAGTGAGGGAAATATGGACATCACATGGAACAACAT CCAGGAGACTCAGGCCTCTAGGAGTAACTGGGTAGTGTGC, in a gene coding for a IL1 receptor antagonist, IL1-RN and ascertaining whether the repeat is present five times.
    Type: Grant
    Filed: February 4, 2019
    Date of Patent: May 16, 2023
    Assignee: KLINIKUM DER UNIVERSITAET MUENCHEN
    Inventors: Burkhard Summer, Peter Thomas, Sylvia Usbeck, Diana Lill
  • Patent number: 11629385
    Abstract: Provided herein are novel organoid culture media, organoid culture systems, and methods of culturing tumor organoids using the subject organoid culture media. Also provided herein are tumor organoids developed using such organoid culture systems, methods for assessing the clonal diversity of the tumor organoids, and methods for using such tumor organoids, for example, for tumor modelling and drug development applications. In particular embodiments, the tumor organoid culture media provided herein is substantially free of R-spondins (e.g., R-spondin1).
    Type: Grant
    Filed: November 22, 2019
    Date of Patent: April 18, 2023
    Assignee: Tempus Labs, Inc.
    Inventors: Ameen Salahudeen, Verónica Sánchez Freire, Brandon L. Mapes
  • Patent number: 11618925
    Abstract: This document provides methods and materials related to genetic variations of developmental disorders. For example, this document provides methods for using such genetic variations to assess susceptibility of developing Autism Spectrum Disorder.
    Type: Grant
    Filed: January 31, 2020
    Date of Patent: April 4, 2023
    Assignee: Population Bio, Inc.
    Inventors: Eli Hatchwell, Peggy S. Eis
  • Patent number: 11613783
    Abstract: The present disclosure provides methods, systems, compositions, and kits for the high-throughput detection of multi-molecule biomarkers in a biological sample. The disclosed methods, systems, compositions, and kits utilize antibody-oligonucleotide tags to detect two or more molecules that are in close proximity.
    Type: Grant
    Filed: December 30, 2021
    Date of Patent: March 28, 2023
    Assignee: Tempus Labs, Inc.
    Inventor: Timothy Rand
  • Patent number: 11613782
    Abstract: The invention provides a gene signature for use in determining a likelihood of a latent tuberculosis (TB) infection in a subject transitioning to active TB disease. The gene signature comprises at least SEPT4 and BLK, and optionally also GAS6 and/or CD1C. Expression levels of these genes are detected in a sample from the subject, and the ratios of expression of at least two of the above genes are calculated (e.g. SEPT4:BLK, SEPT4:CD1C, GAS6:BLK and/or GAS6:CD1C). A score is assigned to each ratio, the score being indicative of the likelihood of the latent TB infection transitioning into active TB disease, based on the ratio for the respective gene pair. The subject can be identified as having a latent TB infection that is likely to transition into active TB disease or that is not likely to transition into active TB disease based on the score or on the average of the scores.
    Type: Grant
    Filed: March 13, 2019
    Date of Patent: March 28, 2023
    Assignees: UNIVERSITY OF CAPE TOWN, STELLENBOSCH UNIVERSITY, SEATTLE CHILDREN'S HOSPITAL, MAX-PLANCK-GESELLSCHAFT ZUR FOERDERUNG DER WISSENSCHAFTEN E.V, UNITED KINGDOM RESEARCH AND INNOVATION
    Inventors: Sara Suliman, Ethan Greene Thompson, Jayne Suzanne Sutherland, Stefan H. E. Kaufmann, Thomas Jens Scriba, Daniel Edward Zak, Gerhard Walzl
  • Patent number: 11591656
    Abstract: Compositions and methods for the detection and treatment of ADHD are provided.
    Type: Grant
    Filed: September 6, 2018
    Date of Patent: February 28, 2023
    Assignee: THE CHILDREN'S HOSPITAL OF PHILADELPHIA
    Inventors: Hakon Hakonarson, Berta Almoguera, Lyam Vazquez, Patrick Sleiman
  • Patent number: 11578367
    Abstract: Methods for predicting the development of sepsis in a subject at risk for developing sepsis are provided. In one method, features in a biomarker profile of the subject are evaluated. The subject is likely to develop sepsis if these features satisfy a particular value set. Methods for predicting the development of a stage of sepsis in a subject at risk for developing a stage of sepsis are provided. In one method, a plurality of features in a biomarker profile of the subject is evaluated. The subject is likely to have the stage of sepsis if these feature values satisfy a particular value set. Methods of diagnosing sepsis in a subject are provided. In one such method, a plurality of features in a biomarker profile of the subject is evaluated. The subject is likely to develop sepsis when the plurality of features satisfies a particular value set.
    Type: Grant
    Filed: October 8, 2019
    Date of Patent: February 14, 2023
    Assignee: Becton, Dickinson and Company
    Inventors: James A. Garrett, Sha-Sha Wang, Keith Thornton, Richard L. Moore, William Keating, William A. Nussbaumer, Craig C. Whiteford
  • Patent number: 11542558
    Abstract: It is intended to provide a kit or a device for the detection of esophageal cancer and a method for detecting esophageal cancer. The present invention provides a kit or a device for the detection of esophageal cancer, comprising nucleic acid(s) capable of specifically binding to miRNA(s) in a sample f a subject, and a method for detecting esophageal cancer, comprising measuring the miRNA in vitro.
    Type: Grant
    Filed: February 27, 2020
    Date of Patent: January 3, 2023
    Assignees: TORAY INDUSTRIES, INC., NATIONAL CANCER CENTER
    Inventors: Hiroko Sudo, Hitoshi Nobumasa, Satoko Kozono, Satoshi Kondou, Junpei Kawauchi, Atsushi Ochiai, Motohiro Kojima
  • Patent number: 11530447
    Abstract: The present invention is directed to methods and kits for determining the presence of a mutated SLC30A2 polynucleotide. The invention is further directed to methods of determining a subject's genetic-susceptibility to zinc deficiency and evaluating zinc levels in a composition comprising breast milk.
    Type: Grant
    Filed: April 11, 2018
    Date of Patent: December 20, 2022
    Assignee: TECHNION RESEARCH & DEVELOPMENT FOUNDATION LIMITED
    Inventors: Yehuda G. Assaraf, Yarden Golan Maor
  • Patent number: 11519927
    Abstract: It is intended to provide a kit or a device for the detection of lung cancer and a method for detecting lung cancer. The present invention provides a kit or a device for the detection of lung cancer, comprising a nucleic acid capable of specifically binding to a miRNA in a sample from a subject, and a method for detecting lung cancer, comprising measuring the miRNA in vitro.
    Type: Grant
    Filed: February 25, 2020
    Date of Patent: December 6, 2022
    Assignees: TORAY INDUSTRIES, INC., NATIONAL CANCER CENTER
    Inventors: Hiroko Sudo, Hitoshi Nobumasa, Satoko Kozono, Satoshi Kondou, Junpei Kawauchi, Atsushi Ochiai, Motohiro Kojima
  • Patent number: 11519038
    Abstract: An object of the present invention is to provide a kit or a device for the detection of prostate cancer and a method for detecting prostate cancer. The present invention provides a kit or a device for the detection of prostate cancer, comprising a nucleic acid capable of specifically binding to a miRNA in a sample of a subject, and a method for detecting prostate cancer, comprising measuring the miRNA in vitro.
    Type: Grant
    Filed: March 3, 2020
    Date of Patent: December 6, 2022
    Assignees: TORAY INDUSTRIES, INC., NATIONAL CANCER CENTER
    Inventors: Satoshi Kondou, Hitoshi Nobumasa, Satoko Kozono, Hiroko Sudo, Junpei Kawauchi, Takahiro Ochiya, Nobuyoshi Kosaka
  • Patent number: 11512355
    Abstract: It is intended to provide a kit or device for the detection of liver cancer and a method for detecting liver cancer. The present invention relates to a kit or device for the detection of liver cancer, comprising a nucleic acid capable of specifically binding to miRNA in a sample of a subject, and a method for detecting liver cancer, comprising measuring the miRNA in vitro.
    Type: Grant
    Filed: February 7, 2020
    Date of Patent: November 29, 2022
    Assignees: TORAY INDUSTRIES, INC., NATIONAL CANCER CENTER
    Inventors: Satoshi Kondou, Hitoshi Nobumasa, Satoko Kozono, Hiroko Sudo, Junpei Kawauchi, Atsushi Ochiai, Motohiro Kojima
  • Patent number: 11499198
    Abstract: The present invention provides a kit or device for the detection of biliary tract cancer, and a method for detecting biliary tract cancer. The present invention relates to a kit or device for the detection of biliary tract cancer, comprising a nucleic acid capable of specifically binding to miRNA in a sample of a subject, and a method for detecting biliary tract cancer, comprising measuring the miRNA in vitro.
    Type: Grant
    Filed: March 18, 2020
    Date of Patent: November 15, 2022
    Assignees: TORAY INDUSTRIES, INC., NATIONAL CANCER CENTER
    Inventors: Junpei Kawauchi, Hitoshi Nobumasa, Satoko Kozono, Satoshi Kondou, Hiroko Sudo, Atsushi Ochiai, Motohiro Kojima
  • Patent number: 11486009
    Abstract: This invention relates to a kit or a device for the detection of stomach cancer and a method for detecting stomach cancer, and provides a kit or a device for the detection of stomach cancer, comprising a nucleic acid(s) capable of specifically binding to a miRNA(s) in a sample from a subject, and a method for detecting stomach cancer, comprising measuring the miRNA(s) in vitro.
    Type: Grant
    Filed: February 13, 2020
    Date of Patent: November 1, 2022
    Assignees: Toray Industries, Inc., National Cancer Center
    Inventors: Satoko Kozono, Hitoshi Nobumasa, Satoshi Kondou, Hiroko Sudo, Junpei Kawauchi, Atsushi Ochiai, Motohiro Kojima
  • Patent number: 11486007
    Abstract: Disclosed herein is a combination of genomic sequences whose methylation patterns have utility for the improved detection and differentiation between colorectal neoplasms. Further disclosed herein are methods, nucleic acids and kits for detecting or differentiating between colorectal neoplasms.
    Type: Grant
    Filed: June 3, 2015
    Date of Patent: November 1, 2022
    Assignees: Quest Diagnostics Investments Incorporated, CLINICAL GENOMICS PTY LTD
    Inventors: Susanne Pedersen, Lawrence LaPointe, Rohan Baker, Amber C. Donahue, Yen-lin Peng, Frederic Waldman
  • Patent number: 11479822
    Abstract: It is intended to provide a kit or a device for the detection of breast cancer and a method for detecting breast cancer. The present invention provides a kit or a device for the detection of breast cancer, comprising nucleic acid(s) capable of specifically binding to a miRNA in a sample of a subject, and a method for detecting breast cancer, comprising measuring the miRNA in vitro.
    Type: Grant
    Filed: February 21, 2020
    Date of Patent: October 25, 2022
    Assignees: TORAY INDUSTRIES, INC., NATIONAL CANCER CENTER
    Inventors: Satoshi Kondou, Hitoshi Nobumasa, Satoko Kozono, Hiroko Sudo, Junpei Kawauchi, Takahiro Ochiya, Nobuyoshi Kosaka, Makiko Ono, Kenji Tamura
  • Patent number: 11479821
    Abstract: It is intended to provide a kit or a device for the detection of colorectal cancer and a method for detecting colorectal cancer. The present invention provides a kit or a device for the detection of colorectal cancer, comprising a nucleic acid capable of specifically binding to a miRNA in a sample from a subject, and a method for detecting colorectal cancer, comprising measuring the miRNA in vitro.
    Type: Grant
    Filed: February 13, 2020
    Date of Patent: October 25, 2022
    Assignees: TORAY INDUSTRIES, INC., NATIONAL CANCER CENTER
    Inventors: Satoko Kozono, Hitoshi Nobumasa, Satoshi Kondou, Hiroko Sudo, Junpei Kawauchi, Atsushi Ochiai, Motohiro Kojima
  • Patent number: 11473143
    Abstract: The present invention relates to the proline rich transmembrane protein 2 (PRRT2) gene, and the identification of mutations and variations in PRRT2 that give rise to seizure and movement disorders. Accordingly, the present invention provides methods for the diagnosis or prognosis of such disorders by identifying alterations in the PRRT2 gene. Identification of alterations in the PRRT2 gene also enables the identification of subjects with an increased likelihood of having an offspring predisposed to such disorders. The present invention also provides an isolated nucleic acid molecule comprising an alteration in the PRRT2 gene, wherein said alteration produces a seizure and/or movement disorder phenotype. Also provided is an isolated PRRT2 polypeptide that comprises an alteration which produces a seizure and/or movement disorder phenotype.
    Type: Grant
    Filed: July 28, 2017
    Date of Patent: October 18, 2022
    Assignees: The University of Melbourne, Central Adelaide Local Health Network Incorporated, Itek Ventures PTY Ltd (University of South Australia)
    Inventors: Sarah Elizabeth Heron, Leanne Michelle Dibbens, Samuel Frank Berkovic, Ingrid Eileen Scheffer, John Charles Mulley
  • Patent number: 11453914
    Abstract: Provided are methods for detecting or diagnosing a traumatic brain injury or TBI by detecting concentration levels miRNAs associated with TBI in saliva. Methods for controlled and normalized comparisons of salivary miRNA concentration levels are further provided. Assay kits comprising salivary miRNAs, probes and/or primers for detecting salivary miRNAs are also provided.
    Type: Grant
    Filed: March 23, 2018
    Date of Patent: September 27, 2022
    Assignees: QUADRANT BIOSCIENCES INC., THE RESEARCH FOUNDATION FOR THE STATE UNIVERSITY OF NEW YORK, PENN STATE RESEARCH FOUNDATION
    Inventors: Steven D. Hicks, Frank A. Middleton, Richard Uhlig
  • Patent number: 11441191
    Abstract: The present invention relates to refined prognostic clinical tools, methods, and kits for the evaluation of risk and treatment of distant recurrence in ER+/HER2? breast cancer patients.
    Type: Grant
    Filed: June 19, 2017
    Date of Patent: September 13, 2022
    Assignees: Istituto Europeo di Oncologia S.r.l., Fondazione Istituto Firc di Oncologia Molecolare (IFOM), University of Milan
    Inventors: Pier Paolo Di Fiore, Salvatore Pece, Manuela Vecchi, Stefano Confalonieri