Patents by Inventor Ajit Shasany

Ajit Shasany has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Publication number: 20090191292
    Abstract: The present invention relates to the development of a novel high herb yielding essential oil herb variety of Krishna Tulsi (botanically known as Ocimum sanctum, from the Family—Lamiaceae, 2n=32), and hereinafter named as ‘CIM-AYU’. In particular, the invention is related to the development of a high eugenol yielding variety of Krishna Tulsi named ‘CIM-AYU’ through open pollination in the germplasm followed by recurrent progeny selection and evaluation for the yield characters of selected population for 3 years in field conditions. The selected variety is high yielding and stable in subsequent generations. This invention thus relates to the high yielding seeds, plants and plant parts of plant named ‘CIM-AYU’ and its components, to a method of producing named ‘CIM-AYU’, and to a method for producing high eugenol using ‘CIM-AYU’ as a pollinator or parent.
    Type: Application
    Filed: July 6, 2007
    Publication date: July 30, 2009
    Inventors: Raj Lal, Suman Khanuja, Arun Agnihotri, Hari Misra, Ajit Shasany, Ali Naqvi, Om Dhawan, Alok Kalra, Janak Bahl, Mahendra Darokar
  • Publication number: 20070099993
    Abstract: The present invention relates to the new use of an already known biomolecule methyl-?-orcinol carboxylate of formula I isolated from a lichen (Everniastrum cirrhatum), for treating pathogenic fungal infections of humans that are resistant to polyene and azole antibiotics such as amphotericin B, nystatin, clotrimazole etc.
    Type: Application
    Filed: December 7, 2006
    Publication date: May 3, 2007
    Inventors: Suman Khanuja, Ranganathan Tiruppadiripuliyur, Vivek Gupta, Preeti Chand, Ankur Garg, Santosh Srivastava, Subash Verma, Dharmendra Saikia, Mahendra Darokar, Ajit Shasany, Anirban Pal
  • Publication number: 20070092491
    Abstract: The present invention relates to the selection and development of superior strain of Bacillus spp for improving plant growth and health by inhibiting pathogenic fungi
    Type: Application
    Filed: May 18, 2004
    Publication date: April 26, 2007
    Inventors: Abdul Sattar, Mansoor Alam, Abdul Khaliq, Suman Preet Singh Khanuja, Alok Kalra, Abdul Samad, Ajit Shasany, Mahendra Darokar, Ashutosh Shukla, Togarati Padmapriya, Mohammad Yaseen, Om Parkash Dhawan, Mohammad Zaim, Poovappallivadakethil Viswanathan Nair Ajaya Kumar
  • Publication number: 20070060604
    Abstract: The present invention relates to pharmaceutical composition with lysergol as bioactive enhancer and bioavailability facilitator for broad-spectrum antibiotics. The present invention has direct implication in reducing the dosage of antibiotics while increasing the efficiency of absorption of nutritional elements.
    Type: Application
    Filed: April 3, 2006
    Publication date: March 15, 2007
    Applicant: COUNCIL OF SCIENTIFIC AND INDUSTRIAL RESEARCH
    Inventors: Suman Khanuja, Jai Arya, Santosh Srivastava, Ajit Shasany, Tiruppadiripuliyur Santha Kumar, Mahendra Darokar, Sushil Kumar
  • Publication number: 20060101882
    Abstract: The present invention relates to an efficient process of vermicomposting and production of high-quality vermicompost from agro-waste(including distillation waste) using animal urine such as cattle urine.
    Type: Application
    Filed: January 13, 2006
    Publication date: May 18, 2006
    Inventors: Suman Khanuja, Alok Kalra, Ranganathan Tiruppadiripuliyur, Mahendra Darokar, Ajit Shasany, Dharni Patra, Virendra Tomar, Om Dhawan, Rakesh Pandey, Ravi Bansal, Raj Lal, Govind Ram, Anirban Pal
  • Publication number: 20060031957
    Abstract: Indian basil, Ocimum basilicum, belongs to the family of Lamiaceae. The essential oil of Indian basil extracted via hydro or steam distillation from the leaves or whole plants is used to flavour foods, dental and oral products, in fragrances, and in traditional rituals and medicines. Extracted essential oil has also been shown to contain biologically active constituents that are insecticidal, nematicidal, fungistatic or which have antimicrobial properties. The present invention relates to the development of an early, short duration, dwarf, high essential oil, methyl chavicol and linalool yielding variety of Indian basil (Ocimum basilicum), Family—Lamiaceae) named as ‘CIM-SAUMYA’. This new variety of Indian basil was developed through open pollination in the germplasm followed by half-sib progeny selection and evaluation for the yield characters of selected population for 3 years in field conditions.
    Type: Application
    Filed: August 6, 2004
    Publication date: February 9, 2006
    Applicant: COUNCIL OF SCIENTIFIC AND INDUSTRIAL RESEARCH
    Inventors: Suman Khanuja, Raj Lal, Arun Agnihotri, Ajit Shasany, Ali Naqvi, Samresh Dwivedi, Hari Misra, Om Dhawan, Alok Kalra, Aparbal Singh, Janak Bahl, Saudan Singh, Dharani Patra, Shilpi Agarwal, Mahendra Darokar, Anil Gupta, Moti Gupta, Ram Chandra
  • Publication number: 20050223447
    Abstract: The present invention is related to the development of a novel, distinct high herb and artemisinin yielding genotype of Artemisia annua obtained through systematic marker assisted breeding followed by selection of uniform population in a methodical way wherein the genotype is distinct, uniform and stably maintainable by continuous rouging of off types in the population using DNA marker at early seedling stage from nursery itself and suitable for commercial cultivation.
    Type: Application
    Filed: March 26, 2004
    Publication date: October 6, 2005
    Inventors: Suman Preet Khanuja, Shilpi Paul, Ajit Shasany, Anil Gupta, Mahendra Darokar, Madan Gupta, Ram Verma, Govind Ram, Anuraddha Kumar, Raj Lal, Ravi Bansal, Anil Singh, Rajendra Bhakuni, Sudeep Tandon
  • Publication number: 20050181081
    Abstract: The present invention provides an improved preparation based on the synergistic action of garlic extract and essential oil of M. spicata var. Ganga or cinnamon oil against dermatophytic fungus. More particularly, the present invention relates to the synergistic enhancement of activity of a combination by menthyl acetate or Geraniol. The invention also provides a method of preparation of the synergistic combination and the shelf life observed to be more than one year. The cream based preparation is a potent anti-dermatophytic as described and illustrated by in vitro and in vivo evaluations.
    Type: Application
    Filed: January 21, 2004
    Publication date: August 18, 2005
    Inventors: Suman Khanuja, Pushplata Chaturvedi, Anil Singh, Ajit Shasany, Vinay Agarwal, Vivek Gupta, Subhash Gupta, Arun Tripathy, Anirban Pal, Dharmendra Saikia, Mahendra Darokar, Krishna Aggarwal, Ravi Bansal
  • Publication number: 20050181950
    Abstract: This invention provides a plant growth regulatory activity of a new biologically active synthetic molecule methanone-(3?,4?,5?-trimethoxy) phenyl, 1-naphthyl, 2-O-4?-ethyl but-2?-enoate. More particularly, the invention relates to the potent plant growth promoting activity of a gallic acid derivative having a structure represented by Formula 1 and a molecular formulae C26H26O7. This invention also provides a novel process for preparation of said molecule from a naturally occurring compound and testing it for growth regulating activity using Bacopa test system developed at CIMAP (Khanuja et al., 2001).
    Type: Application
    Filed: August 17, 2004
    Publication date: August 18, 2005
    Inventors: Suman Preet Khanuja, Mahendra Darokar, Ankur Garg, Togarrati Padmapriya, Ajit Shasany, Arvind Negi, Sunia Chattopadhyay, Kachin Srivastava, Asish Bhattacharya
  • Publication number: 20050150027
    Abstract: The present invention relates to a new and distinct mint plant of Mentha piperita ‘Cim Indus’, selected through screening, field trial and analysis of monoterpene constituents of the essential oil of the germplasm, possessing the characters of producing high amount of menthofuran ranging between 22 to 30% of total oil content, high amount pulegone ranging between 9.0 to 18% of total oil content, with essential oil content ranging between 0.32 to 0.40% of the total oil content.
    Type: Application
    Filed: December 29, 2003
    Publication date: July 7, 2005
    Applicant: COUNCIL OF SCIENTIFIC AND INDUSTRIAL
    Inventors: Suman Khanuja, Nirmal Patra, Ajit Shasany, Birendra Kumar, Soni Gupta, Rakesh Upadhyay, Togarrati Priya, Anil Singh, Mahendra Darokar, Virendra Tomar, Janak Bahal, Raj Lal
  • Publication number: 20050142564
    Abstract: The present invention relates to a pair of primers with forward primer of SEQ ID NO. 1 having sequence of CCAAGCTTGCTGAACGCATCGG, and reverse primer of SEQ ID No. 2 having sequence of CCAAGCTTGCCACGCAGGATTATC, and a screening method for early identification of plants Artemisia annua having high content of artemisinin and thereby helping generation of plant population with further high content of artemisinin.
    Type: Application
    Filed: March 31, 2004
    Publication date: June 30, 2005
    Inventors: Suman Khanuja, Shilpi Paul, Ajit Shasany, Mahendra Darokar, Ashutosh Shukla, Madan Gupta, Anuruddha Kumar
  • Publication number: 20050100610
    Abstract: The invention relates to a novel pharmaceutical composition comprising an effective amount of bio-active fraction from cow urine distillate as a bioavailability facilitator and pharmaceutically acceptable additives selected from anticancer compounds, antibiotics, drugs, therapeutic and nutraceutic agents, ions and similar molecules which are targeted to the living systems.
    Type: Application
    Filed: April 13, 2004
    Publication date: May 12, 2005
    Applicant: COUNCIL OF SCIENTIFIC AND INDUSTRIAL RESEARCH RAFI MARG
    Inventors: Suman Khanuja, Sushil Kumar, Ajit Shasany, Jai Arya, Mahendra Darokar, Monika Singh, Prachi Sinha, Soumya Awasthi, Subhash Gupta, Vivek Gupta, Madan Gupta, Ram Verma, Sweta Agarwal, Sunil Mansinghka, Suresh Dawle
  • Publication number: 20050091705
    Abstract: The present invention relates to a high herb yielding essential oil herb variety of Krishna Tulsi (Ocimum sanctum, Family—Lamiaceae, 2n=32) named as ‘CIM-AYU’, more particularly, the invention is related to the development of a high eugenol yielding variety of Krishna Tulsi named ‘CIM-AYU’ through open pollination in the germplasm followed by recurrent progeny selection and evaluation for the yield characters of selected population for 3 years in field conditions, the selected variety is high yielding and stable in subsequent generation. This invention thus relates to the high yielding seeds, plants and plant parts of plant named ‘CIM-AYU’ and its components, to a method of producing named ‘CIM-AYU’, and to a method for producing high eugenol using ‘CIM-AYU’ as a pollinator or parent.
    Type: Application
    Filed: August 13, 2003
    Publication date: April 28, 2005
    Inventors: Raj Kishori Lal, Suman Preet Khanuja, Arun Agnihotri, Hari Misra, Ajit Shasany, Ali Arif Naqvi, Om Prakash Dhawan, Alok Kalra, Janak Raj Bahl, Mahendra Pandurang Darokar
  • Publication number: 20050050593
    Abstract: The present invention relates to a cultivar of Phyllanthus amarus ‘CIM-Jeevan’, producing high amount of herb, phyllanthin and hypophyllanthin, wherein said cultivar is developed through y-irradiation of superior gemplasm, the said plant produces high amount of herbage yield ranging between 1.0-1.15 kg per sqm fresh total plant herb, possesses high vegetative erect growth with a height ranging between 60 to 65 cm, produces phyllanthin ranging between 0.70-0.77% in dry herb, produces hypophyllanthin ranging between 0.32-0.37% in dry herb, and shows seed germination of about 90%.
    Type: Application
    Filed: August 25, 2003
    Publication date: March 3, 2005
    Inventors: Anil Gupta, Suman Khanuja, Madan Gupta, Ajit Shasany, Neeraj Jain, Ram Verma, Mahendra Darokar, Guru Bagchi, Sushil Kumar
  • Publication number: 20050048532
    Abstract: The present invention relates to an alpha-arteether resistance domain (ADR) of Sequence ID No.1 and a method of identifying ADR in alpha-arteether resistant pathogens and lastly, it relates to set three pairs of primers of sequence ID Nos. 3 to 8.
    Type: Application
    Filed: March 26, 2004
    Publication date: March 3, 2005
    Inventors: Suman Preet Khanuja, Suchi Srivastava, Ajit Shasany, Tiruppadiripuliyur Ranganathan Kumar, Mahendra Darokar, Preeti Chand, Sushil Kumar
  • Publication number: 20050044600
    Abstract: The present invention relates to the development of a novel multiutility vigorously growing robust mint plant ‘Ganga’ of Mentha spicata L. var. viridis producing essential oil exhibiting anti-insect and anti-microbial activities and useful for agrochemical and pharmaceutical purposes.
    Type: Application
    Filed: May 7, 2004
    Publication date: February 24, 2005
    Applicant: Council of Scientific and Industrial Research
    Inventors: Suman Khanuja, Sushil Kumar, Ajit Shasany, Sunita Dhawan, Mahendra Darokar, Arun Tripathy, Sarita Satapathy, Tiruppadiripuliyur Kumar, Vivek Gupta, Arvind Tripathi, Soumya Awasthi, Veena Prajapati, Ali Naqvi, Krishna Agrawal, Janak Bahl, Anil Singh, Ateeque Ahmed, Ravi Bansal, Alok Krishna, Dharmendra Saikia