Abstract: The present invention relates to the development of a novel high herb yielding essential oil herb variety of Krishna Tulsi (botanically known as Ocimum sanctum, from the Family—Lamiaceae, 2n=32), and hereinafter named as ‘CIM-AYU’. In particular, the invention is related to the development of a high eugenol yielding variety of Krishna Tulsi named ‘CIM-AYU’ through open pollination in the germplasm followed by recurrent progeny selection and evaluation for the yield characters of selected population for 3 years in field conditions. The selected variety is high yielding and stable in subsequent generations. This invention thus relates to the high yielding seeds, plants and plant parts of plant named ‘CIM-AYU’ and its components, to a method of producing named ‘CIM-AYU’, and to a method for producing high eugenol using ‘CIM-AYU’ as a pollinator or parent.

Abstract: The present invention relates to the new use of an already known biomolecule methyl-?-orcinol carboxylate of formula I isolated from a lichen (Everniastrum cirrhatum), for treating pathogenic fungal infections of humans that are resistant to polyene and azole antibiotics such as amphotericin B, nystatin, clotrimazole etc.

Abstract: The present invention relates to the selection and development of superior strain of Bacillus spp for improving plant growth and health by inhibiting pathogenic fungi

Abstract: The present invention relates to pharmaceutical composition with lysergol as bioactive enhancer and bioavailability facilitator for broad-spectrum antibiotics. The present invention has direct implication in reducing the dosage of antibiotics while increasing the efficiency of absorption of nutritional elements.

Abstract: The present invention relates to an efficient process of vermicomposting and production of high-quality vermicompost from agro-waste(including distillation waste) using animal urine such as cattle urine.

Abstract: Indian basil, Ocimum basilicum, belongs to the family of Lamiaceae. The essential oil of Indian basil extracted via hydro or steam distillation from the leaves or whole plants is used to flavour foods, dental and oral products, in fragrances, and in traditional rituals and medicines. Extracted essential oil has also been shown to contain biologically active constituents that are insecticidal, nematicidal, fungistatic or which have antimicrobial properties. The present invention relates to the development of an early, short duration, dwarf, high essential oil, methyl chavicol and linalool yielding variety of Indian basil (Ocimum basilicum), Family—Lamiaceae) named as ‘CIM-SAUMYA’. This new variety of Indian basil was developed through open pollination in the germplasm followed by half-sib progeny selection and evaluation for the yield characters of selected population for 3 years in field conditions.

Abstract: The present invention is related to the development of a novel, distinct high herb and artemisinin yielding genotype of Artemisia annua obtained through systematic marker assisted breeding followed by selection of uniform population in a methodical way wherein the genotype is distinct, uniform and stably maintainable by continuous rouging of off types in the population using DNA marker at early seedling stage from nursery itself and suitable for commercial cultivation.

Abstract: The present invention provides an improved preparation based on the synergistic action of garlic extract and essential oil of M. spicata var. Ganga or cinnamon oil against dermatophytic fungus. More particularly, the present invention relates to the synergistic enhancement of activity of a combination by menthyl acetate or Geraniol. The invention also provides a method of preparation of the synergistic combination and the shelf life observed to be more than one year. The cream based preparation is a potent anti-dermatophytic as described and illustrated by in vitro and in vivo evaluations.

Abstract: This invention provides a plant growth regulatory activity of a new biologically active synthetic molecule methanone-(3?,4?,5?-trimethoxy) phenyl, 1-naphthyl, 2-O-4?-ethyl but-2?-enoate. More particularly, the invention relates to the potent plant growth promoting activity of a gallic acid derivative having a structure represented by Formula 1 and a molecular formulae C26H26O7. This invention also provides a novel process for preparation of said molecule from a naturally occurring compound and testing it for growth regulating activity using Bacopa test system developed at CIMAP (Khanuja et al., 2001).

Abstract: The present invention relates to a new and distinct mint plant of Mentha piperita ‘Cim Indus’, selected through screening, field trial and analysis of monoterpene constituents of the essential oil of the germplasm, possessing the characters of producing high amount of menthofuran ranging between 22 to 30% of total oil content, high amount pulegone ranging between 9.0 to 18% of total oil content, with essential oil content ranging between 0.32 to 0.40% of the total oil content.

Abstract: The present invention relates to a pair of primers with forward primer of SEQ ID NO. 1 having sequence of CCAAGCTTGCTGAACGCATCGG, and reverse primer of SEQ ID No. 2 having sequence of CCAAGCTTGCCACGCAGGATTATC, and a screening method for early identification of plants Artemisia annua having high content of artemisinin and thereby helping generation of plant population with further high content of artemisinin.

Abstract: The invention relates to a novel pharmaceutical composition comprising an effective amount of bio-active fraction from cow urine distillate as a bioavailability facilitator and pharmaceutically acceptable additives selected from anticancer compounds, antibiotics, drugs, therapeutic and nutraceutic agents, ions and similar molecules which are targeted to the living systems.

Abstract: The present invention relates to a high herb yielding essential oil herb variety of Krishna Tulsi (Ocimum sanctum, Family—Lamiaceae, 2n=32) named as ‘CIM-AYU’, more particularly, the invention is related to the development of a high eugenol yielding variety of Krishna Tulsi named ‘CIM-AYU’ through open pollination in the germplasm followed by recurrent progeny selection and evaluation for the yield characters of selected population for 3 years in field conditions, the selected variety is high yielding and stable in subsequent generation. This invention thus relates to the high yielding seeds, plants and plant parts of plant named ‘CIM-AYU’ and its components, to a method of producing named ‘CIM-AYU’, and to a method for producing high eugenol using ‘CIM-AYU’ as a pollinator or parent.

Abstract: The present invention relates to an alpha-arteether resistance domain (ADR) of Sequence ID No.1 and a method of identifying ADR in alpha-arteether resistant pathogens and lastly, it relates to set three pairs of primers of sequence ID Nos. 3 to 8.

Abstract: The present invention relates to a cultivar of Phyllanthus amarus ‘CIM-Jeevan’, producing high amount of herb, phyllanthin and hypophyllanthin, wherein said cultivar is developed through y-irradiation of superior gemplasm, the said plant produces high amount of herbage yield ranging between 1.0-1.15 kg per sqm fresh total plant herb, possesses high vegetative erect growth with a height ranging between 60 to 65 cm, produces phyllanthin ranging between 0.70-0.77% in dry herb, produces hypophyllanthin ranging between 0.32-0.37% in dry herb, and shows seed germination of about 90%.

Abstract: The present invention relates to the development of a novel multiutility vigorously growing robust mint plant ‘Ganga’ of Mentha spicata L. var. viridis producing essential oil exhibiting anti-insect and anti-microbial activities and useful for agrochemical and pharmaceutical purposes.