Abstract: A method and a kit for detecting methicillin-resistant Staphylococcus aureus which use, as primers in a gene amplification reaction, the four oligonucleotides represented by the following nucleotide sequences (1) through (4):5'AGAAATGACTGAACGTCCG3' (SEQ ID NO:1) (1)5'GCGATCAATGTTACCGTAG3' (SEQ ID NO:2) (2)5'TACATGTCGTTAAACCTGGTG3' (SEQ ID NO:3) (3)5'TACAGTTGTACCGATGAATGG3' (SEQ ID NO:4) (4)wherein A, G, C, and T denote adenine, guanine, cytosine, and thymine, respectively, and any T may be substituted by uracil (U). According to the method and kit of the present invention, it is possible to detect MRSA accurately and rapidly while distinguishing it from MR-CNS. Thus, proper treatment and prevention can be achieved against MRSA infections.

Abstract: A nucleic acid differentiating method is provided which involves using a primer having a detectable label introduced therein and a primer having a solid matrix-binding site introduced therein, amplifying a particular region of a target nucleic acid in a sample to thereby produce a labeled sample DNA, adding to this labeled sample DNA at least an equimolar amount of an unlabeled standard DNA to be evaluated for its sequence matching with the sample DNA, effecting competitive hybridization, and at the end of reaction, determining the label intensity of the hybridization product, for thereby determining the presence/absence of a mutant gene in the nucleic acid, the ratio of normal to mutant genes, or the sequence matching of a particular gene among a plurality of samples.

Abstract: An intended nucleic acid is determined in a sample by a method in which at least one of the nucleic acid strands of the intended nucleic acid is subjected to hybridization with a primer and to chain-extension reaction over the primer to form a synthesized nucleic acid which is complementary to and in hybridization with the strand; a copy of the intended nucleic acid is obtained, which copy is (a) the nucleic acid of the double-stranded double produced by the chain-extension reaction, or (b) the synthesized nucleic acid freed from the double-stranded nucleic acid, or (c) a double stranded nucleic acid form from a pair of the synthesized nucleic acids complementary with each other; and it is determined whether the copy is present in the sample thereby to know whether the intended nucleic acid is in present in the sample.

Abstract: The present invention discloses a primer for detecting methicillin-resistant or toxic shock syndrome toxin-1 Staphylococcus spp. comprising any one of nucleotide fragments of sequences (1) to (4):5'GAAATGACTGAACGTCCGAT (1)5'GCGATCAATGTTACCGTAGT (2)5'AGTATGGGCCAAAGTTCGAT (3)5'CACTTTGATATGTGGATCCG (4)a method and kit for detecting these bacteria using the primer. The present invention makes direct and rapid detection of MRS and/or TPS from samples possible, and enables patients with infections caused by these bacteria to be treated at an early stage.

Abstract: A poly-labelled oligonucleotide having a plurality of labels, comprising labels carried on a polylysine and having the polylysine introduced on the extension from 5'- and/or 3'-end through phosphate group is useful as a probe for hybridization.

Abstract: A method of treating hypoproteinemia is disclosed in which an enteric film coated IgA-rich gamma globulin is administered orally to a person suffering therefrom until total serum content and plasma content are restored. The film coating is soluble in neutral or alkaline media by insoluble in acid media.