Patents by Inventor Anna Elgart

Anna Elgart has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Patent number: 12161763
    Abstract: Provided is a formulation and method for increasing bioavailability of an orally administered drug.
    Type: Grant
    Filed: September 20, 2019
    Date of Patent: December 10, 2024
    Assignee: YISSUM RESEARCH DEVELOPMENT COMPANY OF THE HEBREW UNIVERSITY OF JERUSALEM LTD.
    Inventors: Amnon Hoffman, Abraham J. Domb, Anna Elgart, Irina Cherniakov
  • Publication number: 20240335391
    Abstract: The application discloses a formulation and method for increasing bioavailability of an orally administered drug.
    Type: Application
    Filed: June 18, 2024
    Publication date: October 10, 2024
    Applicant: Yissum Research Development Company of the Hebrew University of Jerusalem Ltd.
    Inventors: Amnon HOFFMAN, Abraham J. DOMB, Anna ELGART, Irina CHERNIAKOV
  • Publication number: 20200009067
    Abstract: Provided is a formulation and method for increasing bioavailability of an orally administered drug.
    Type: Application
    Filed: September 20, 2019
    Publication date: January 9, 2020
    Applicant: Yissum Research Development Company of the Hebrew University of Jerusalem Ltd.
    Inventors: Amnon HOFFMAN, Abraham J. DOMB, Anna ELGART, Irina CHERNIAKOV
  • Patent number: 9364496
    Abstract: The present invention provides a method for providing antisense therapy which reduces the expression of clusterin to provide therapeutic benefit in the treatment of cancer, comprising administering an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2?-O-methoxyethyl modifications, has nucleotides 5-17 which are 2?deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19, to a human subject in need of treatment for the cancer, which human subject also receives at least one chemotherapeutic agent, hormone ablation therapy, or radiation therapy, wherein the anti-clusterin oligonucleotide is administered at least 3 times during a 5 to 9 day period, wherein at least 1 of the administrations is at a dose other than 640 mg.
    Type: Grant
    Filed: March 12, 2014
    Date of Patent: June 14, 2016
    Assignee: ONCOGENEX TECHNOLOGIES INC.
    Inventors: Laura Rabinovich-Guilatt, Anna Elgart
  • Publication number: 20140348926
    Abstract: The application discloses a formulation and method for increasing bioavailability of an orally administered drug.
    Type: Application
    Filed: January 17, 2013
    Publication date: November 27, 2014
    Inventors: Amnon Hoffman, Abraham J. Domb, Anna Elgart, Irina Cherniakov
  • Publication number: 20140275214
    Abstract: The present invention provides a method for providing antisense therapy which reduces the expression of clusterin to provide therapeutic benefit in the treatment of cancer, comprising administering an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2?-O-methoxyethyl modifications, has nucleotides 5-17 which are 2? deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19, to a human subject in need of treatment for the cancer, which human subject also receives at least one chemotherapeutic agent, hormone ablation therapy, or radiation therapy, wherein the anti-clusterin oligonucleotide is administered at least 3 times during a 5 to 9 day period, wherein at least 1 of the administrations is at a dose other than 640 mg.
    Type: Application
    Filed: March 12, 2014
    Publication date: September 18, 2014
    Applicant: TEVA PHARMACEUTICAL INDUSTRIES, LTD.
    Inventors: Laura Rabinovich-Guilatt, Anna Elgart