Abstract: The application discloses a formulation and method for increasing bioavailability of an orally administered drug.

Abstract: The disclosure provides pharmaceutical compositions for subcutaneous administration comprising olanzapine, and organic solvent, and a triblock copolymer, and a diblock copolymer, as well as methods of treating psychiatric diseases and disorders using such compositions.

Abstract: The present invention is directed to methods of treating psychiatric diseases and disorders comprising administering to a subject in need thereof at a frequency of no more than once every 28 days an injectable formulation comprising risperidone, triblock and diblock copolymers wherein the concentration of the risperidone is 250-400 mg/mL and injection volume is 1 mL or less.

Abstract: The present invention provides engineered penicillin G acylase (PGA) enzymes, polynucleotides encoding the enzymes, compositions comprising the enzymes, and methods of using the engineered PGA enzymes.

Abstract: The disclosure provides pharmaceutical compositions for subcutaneous administration comprising olanzapine, and organic solvent, and a triblock copolymer, and a diblock copolymer, as well as methods of treating psychiatric diseases and disorders using such compositions.

Abstract: The present invention is directed to methods of treating psychiatric diseases and disorders comprising administering to a subject in need thereof at a frequency of no more than once every 28 days an injectable formulation comprising risperidone, triblock and diblock copolymers wherein the concentration of the risperidone is 250-400 mg/mL and injection volume is 1 mL or less.

Abstract: Provided is a formulation and method for increasing bioavailability of an orally administered drug.

Abstract: The present invention provides a method for providing antisense therapy which reduces the expression of clusterin to provide therapeutic benefit in the treatment of cancer, comprising administering an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2?-O-methoxyethyl modifications, has nucleotides 5-17 which are 2?deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19, to a human subject in need of treatment for the cancer, which human subject also receives at least one chemotherapeutic agent, hormone ablation therapy, or radiation therapy, wherein the anti-clusterin oligonucleotide is administered at least 3 times during a 5 to 9 day period, wherein at least 1 of the administrations is at a dose other than 640 mg.

Abstract: The application discloses a formulation and method for increasing bioavailability of an orally administered drug.

Abstract: The present invention provides a method for providing antisense therapy which reduces the expression of clusterin to provide therapeutic benefit in the treatment of cancer, comprising administering an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2?-O-methoxyethyl modifications, has nucleotides 5-17 which are 2? deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19, to a human subject in need of treatment for the cancer, which human subject also receives at least one chemotherapeutic agent, hormone ablation therapy, or radiation therapy, wherein the anti-clusterin oligonucleotide is administered at least 3 times during a 5 to 9 day period, wherein at least 1 of the administrations is at a dose other than 640 mg.