Patents by Inventor Anthony Lawrence Cunningham

Anthony Lawrence Cunningham has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • EPITOPES OF HERPES SIMPLEX VIRUS
    Publication number: 20160317649
    Abstract: The present invention relates to diagnosis, prevention and treatment of Herpes simplex viruses and infection. In particular embodiments the present invention relates to methods and compositions for the prophylactic or therapeutic immunization against of infections of HSV. The present invention also relates to methods and compositions for diagnosis of the presence of and level of immunity to HSV. The invention also relates to peptide epitopes of HSV, in particular peptide epitopes of HSV2 glycoprotein D, to compositions thereof and to the use of such epitopes and compositions in methods for diagnosis, prevention and treatment of HSV.
    Type: Application
    Filed: May 17, 2016
    Publication date: November 3, 2016
    Inventors: Anthony Lawrence Cunningham, Min Kim
  • EPITOPES OF HERPES SIMPLEX VIRUS
    Publication number: 20130273088
    Abstract: The present invention relates to diagnosis, prevention and treatment of Herpes simplex viruses and infection. In particular embodiments the present invention relates to methods and compositions for the prophylactic or therapeutic immunization against of infections of HSV. The present invention also relates to methods and compositions for diagnosis of the presence of and level of immunity to HSV. The invention also relates to peptide epitopes of HSV, in particular peptide epitopes of HSV2 glycoprotein D, to compositions thereof and to the use of such epitopes and compositions in methods for diagnosis, prevention and treatment of HSV.
    Type: Application
    Filed: July 7, 2008
    Publication date: October 17, 2013
    Inventors: Anthony Lawrence Cunningham, Min Kim
  • Method of preventing transport of a neurotropic virus and identifying agents for achieving same
    Patent number: 6953661
    Abstract: A method of preventing transport of a Herpes simplex virus within a neuron, comprising preventing interaction between a structural tegument protein US11 of the virus and a motor protein, Kinesin in the neuron such that virus transport in the neuron is prevented. An antiviral composition is also provided, comprising a compound capable of preventing interaction between a structural tegument protein of a neurotropic virus and a neuron or cell.
    Type: Grant
    Filed: July 20, 2000
    Date of Patent: October 11, 2005
    Assignees: Westmead Hospital, The University of Sydney
    Inventors: Russell John Diefenbach, Monica Miranda-Saksena, Eve Margaret Diefenbach, David James Holland, Anthony Lawrence Cunningham, Mark Penfold, Patricia Joan Armati
  • Detection of human herpes virus 6 (HHV6)
    Publication number: 20040018488
    Abstract: The present invention relates to methods for detecting viral pathogens, particularly human herpes virus 6 (HHV6), preferable using polymerase chain reaction (PCR) techniques. The present invention also relates to primer sequences useful in these methods. In a first aspect, the present invention consists in an isolated nucleic acid molecule complementary to and specific for human herpes virus 6 (HHV6) DNA including a sequence selected from the group consisting of 5′ CTTCTGTTTTACAGGAGT (SEQ ID NO:1). 5′ACAATTGCCATTTCGGGGAAGTAC (SEQ ID N0:2), and functionally equivalent sequences.
    Type: Application
    Filed: July 31, 2003
    Publication date: January 29, 2004
    Applicant: Westmead Institute of Health Research
    Inventors: Vigneswary Mala Ratnamohan, Anthony Lawrence Cunningham
  • Detection of human herpes virus 6 (HHV6)
    Patent number: 6627418
    Abstract: The present invention relates to methods for detecting viral pathogens, particularly human herpes virus S (HHV6), preferably using polymerase chain reaction (PCR) techniques. Primer sequences useful in these methods are also described. In a first aspect, the invention provides an isolated nucleic add molecule complementary to and specific for human herpes virus 6 (HHV6) DNA including a sequence selected from 5′CTTCTGTTTTAAGTCGTACAGGAGT (SEQ ID NO: 1), 5′ACAATTGCCATTTCGGGGAAGTAC (SEQ ID NO: 2), and functionally equivalent sequences. A method for detecting HHV6 in a sample suspected of containing HHV6 is also provided.
    Type: Grant
    Filed: May 15, 2001
    Date of Patent: September 30, 2003
    Assignee: Westmead Institute of Health Research
    Inventors: Vigneswary Mala Ratnamohan, Anthony Lawrence Cunningham