Patents by Inventor Ashutosh Kumar Shukla

Ashutosh Kumar Shukla has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Primers and a screening method for identification of artemisinin producing plants
    Patent number: 7473768
    Abstract: The present invention relates to a pair of primers with forward primer of SEQ ID NO. 1 having sequence of CCAAGCTTGCTGAACGCATCGG, and reverse primer of SEQ ID No. 2 having sequence of CCAAGCTTGCCACGCAGGATTATC, and a screening method for early identification of plants Artemisia annua having high content of artemisinin and thereby helping generation of plant population with further high content of artemisinin.
    Type: Grant
    Filed: March 31, 2004
    Date of Patent: January 6, 2009
    Assignee: Council of Scientific & Industrial Research
    Inventors: Suman Preet Singh Khanuja, Shilpi Paul, Ajit Kumar Shasany, Mahendra Pandurang Darokar, Ashutosh Kumar Shukla, Madan Mohan Gupta, Anuruddha Kumar
  • Strain of as a bioinoculant
    Patent number: 7211428
    Abstract: The present invention relates to the selection and development of superior strain of Bacillus spp for improving plant growth and health by inhibiting pathogenic fungi.
    Type: Grant
    Filed: May 18, 2004
    Date of Patent: May 1, 2007
    Assignee: Council of Scientific and Industrial Research
    Inventors: Abdul Sattar, Mansoor Alam, Abdul Khaliq, Suman Preet Singh Khanuja, Alok Kalra, Abdul Samad, Ajit Kumar Shasany, Mahendra Pandurang Darokar, Ashutosh Kumar Shukla, Togarati Padmapriya, Mohammad Yaseen, Om Parkash Dhawan, Mohammad Zaim, Poovappallivadakethil Viswanathan Nair Ajaya Kumar