Patents by Inventor Ashutosh Kumar

Ashutosh Kumar has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Publication number: 20090239300
    Abstract: The present invention provides a novel material useful for selectively isolating a cell such as monocyte and the like or a protein from a body fluid and a production method thereof, a physiological material using the material and an isolation material using the physiological material, as well as a method of harvesting a cell such as monocyte and the like using the isolation material, a method of harvesting a protein and a method of preparing a dendritic cell.
    Type: Application
    Filed: May 25, 2007
    Publication date: September 24, 2009
    Applicant: KANEKA CORPORATION
    Inventors: Hiroshi Awaji, Ashutosh Kumar, Akira Kobayashi, Naohiro Imai
  • Patent number: 7473768
    Abstract: The present invention relates to a pair of primers with forward primer of SEQ ID NO. 1 having sequence of CCAAGCTTGCTGAACGCATCGG, and reverse primer of SEQ ID No. 2 having sequence of CCAAGCTTGCCACGCAGGATTATC, and a screening method for early identification of plants Artemisia annua having high content of artemisinin and thereby helping generation of plant population with further high content of artemisinin.
    Type: Grant
    Filed: March 31, 2004
    Date of Patent: January 6, 2009
    Assignee: Council of Scientific & Industrial Research
    Inventors: Suman Preet Singh Khanuja, Shilpi Paul, Ajit Kumar Shasany, Mahendra Pandurang Darokar, Ashutosh Kumar Shukla, Madan Mohan Gupta, Anuruddha Kumar
  • Publication number: 20070226040
    Abstract: Determining product marketability may be accomplished by electronically performing various calculations on related data. The marketability may be determined by a processing device receiving business characteristic terms, industry sub-segment terms and validation terms for each business characteristic term of each industry sub-segment. The processing device calculates one or more criteria terms based on the validation terms and thereupon prioritizes the business characteristic terms based on the criteria data to define at least a first cluster of business characteristic terms. The processing device thereupon calculates a coverage percentage term for each of the industry sub-segment terms based on a comparison of the validation terms for each of the business characteristic terms and the validation terms for each business characteristic term in the first cluster. The coverage percentage term usable for determining product marketability.
    Type: Application
    Filed: March 23, 2006
    Publication date: September 27, 2007
    Inventors: Ashutosh Kumar, Stefan Witzens, Oswald Wieser
  • Patent number: 7211428
    Abstract: The present invention relates to the selection and development of superior strain of Bacillus spp for improving plant growth and health by inhibiting pathogenic fungi.
    Type: Grant
    Filed: May 18, 2004
    Date of Patent: May 1, 2007
    Assignee: Council of Scientific and Industrial Research
    Inventors: Abdul Sattar, Mansoor Alam, Abdul Khaliq, Suman Preet Singh Khanuja, Alok Kalra, Abdul Samad, Ajit Kumar Shasany, Mahendra Pandurang Darokar, Ashutosh Kumar Shukla, Togarati Padmapriya, Mohammad Yaseen, Om Parkash Dhawan, Mohammad Zaim, Poovappallivadakethil Viswanathan Nair Ajaya Kumar