Patents by Inventor Aurelie Avril

Aurelie Avril has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Publication number: 20240392300
    Abstract: The invention relates to nucleic acids and methods for restoring acid alpha-glucosidase (GAA) activity in patients with Pompe disease using splice-switching technology.
    Type: Application
    Filed: August 13, 2024
    Publication date: November 28, 2024
    Inventors: Luis Garcia, Aurelie Avril
  • Publication number: 20240368591
    Abstract: Disclosed is an oligomeric compound comprising from 10 to 50 monomer subunits, at least part of the sequence of which is complementary to the following sequence: AAGGAAACUGCCAUCUCCAA (SEQ ID NO: 1 in the appended sequence listing). Also disclosed is a pharmaceutical composition comprising said oligomeric compound and use for treating Duchenne Muscular Dystrophy.
    Type: Application
    Filed: October 4, 2021
    Publication date: November 7, 2024
    Inventors: Luis GARCIA, Aurélie GOYENVALLE, Fedor SVINARTCHOUK, Graziella GRIFFITH, Aurélie AVRIL-DELPLANQUE
  • Patent number: 12091665
    Abstract: The invention relates to nucleic acids and methods for restoring acid alpha-glucosidase (GAA) activity in patients with Pompe disease using splice-switching technology.
    Type: Grant
    Filed: August 3, 2021
    Date of Patent: September 17, 2024
    Assignee: Synthena AG
    Inventors: Luis Garcia, Aurelie Avril
  • Publication number: 20220213485
    Abstract: The invention relates to nucleic acids and methods for restoring acid alpha-glucosidase (GAA) activity in patients with Pompe disease using splice-switching technology.
    Type: Application
    Filed: August 3, 2021
    Publication date: July 7, 2022
    Inventors: Luis Garcia, Aurelie Avril
  • Patent number: 11104903
    Abstract: The invention relates to nucleic acids and methods for restoring acid alpha-glucosidase (GAA) activity in patients with Pompe disease using splice-switching technology.
    Type: Grant
    Filed: July 23, 2018
    Date of Patent: August 31, 2021
    Assignee: SYNTHENA AG
    Inventors: Luis Garcia, Aurelie Avril
  • Publication number: 20190169618
    Abstract: The invention relates to nucleic acids and methods for restoring acid alpha-glucosidase (GAA) activity in patients with Pompe disease using splice-switching technology.
    Type: Application
    Filed: July 23, 2018
    Publication date: June 6, 2019
    Inventors: Luis GARCIA, Aurelie AVRIL
  • Patent number: 10059947
    Abstract: The invention relates to nucleic acids and methods for restoring acid alpha-glucosidase (GAA) activity in patients with Pompe disease using splice-switching technology.
    Type: Grant
    Filed: September 10, 2014
    Date of Patent: August 28, 2018
    Assignee: SYNTHENA AG
    Inventors: Luis Garcia, Aurelie Avril
  • Publication number: 20160215291
    Abstract: The invention relates to nucleic acids and methods for restoring acid alpha-glucosidase (GAA) activity in patients with Pompe disease using splice-switching technology.
    Type: Application
    Filed: September 10, 2014
    Publication date: July 28, 2016
    Inventors: Luis Garcia, Aurelie Avril