Abstract: The present invention provides a composition for use in treating or preventing neoplasia, comprising an effective actein. The present invention also provides a composition for use in treating or preventing neoplasia, comprising an effective anti-neoplastic amount of an ethyl acetate extract of black cohosh. The present invention further provides a combination of anti-neoplastic agents, comprising an effective anti-neoplastic amount of an ethyl acetate extract of black cohosh and an effective anti-neoplastic amount of at least one additional chemopreventive or chemotherapeutic agent. Methods for treating and preventing neoplasia are also provided.

Abstract: A furniture cover is provided that has a substantially t-shaped, substantially continuous, fabric body having a generally elongated central trunk portion, and two outwardly extending arm portions. The central trunk portion is sized to extend over and substantially across the back, seat and front of a seating device. The arm portions are sized to extend over and substantially across the arms of the seating device. The fabric body has a first layer of comfort fabric for exposure to the user; and a second layer of waterproof fabric, seamed around a perimeter edge to the first layer, so that the second layer provides a waterproof barrier across the covered portions of the seating device.

Abstract: A liquid absorbing pad comprising a top layer and a bottom layer and an interior portion therebetween. The interior portion includes a liquid absorbing material. The top layer is made from microfiber bed sheet material. The bottom layer is made from microfiber terry, preferably non-oiled, the top of which is laminated with liquid-impermeable material. The top layer and interior portion are quilted together and glued to the bottom layer. When the pad is laid on a bed sheet made of microfiber bed sheet material extending horizontally, the pad resists horizontal movement relative to the bed sheet. The interior portion preferably may further includes a non-woven polypropylene layer below the liquid absorbing material so that the top layer, the liquid absorbing material and polypropylene layer are quilted together.

Abstract: A low-profile insect-proof closure is provided for an encasement of insect-impervious fabric. A zipper is provided for closing an opening in the encasement. The zipper is stitched to the encasement and has a zipper head, and a zipper track on a fabric zipper belt. A fabric backing panel is stitched to the encasement behind the zipper at a closure zone of the zipper. A finger-shaped insert is provided attached to the fabric backing panel. The insert, which is made of compressible elastomer, is arranged so as to physically block or apply pressure to the zipper head to keep the zipper head in closed position when the encasement is on the mattress. The insert has a width no greater than the width of the zipper belt and a thickness less than about 10 millimeters.

Abstract: A military or uniform hat comprising a frame having an annular headband and visor connected thereto. A stay is connected to the frame and extends outwardly, above the visor so as to at least partially define a frontal portion of the hat. The stay includes an elongated channel formed rearward of a front face of the stay and structured to enclose and support at least a portion of the length of a grommet used to support an at least partially configure a cover of the hat. The stay includes an at least partially smooth, substantially uninterrupted front surface and oppositely disposed open ends of the channel cooperatively configured to eliminate or significantly reduce the possibility of any unsightly deformations, protrusions, etc. observable on the portion of the cover overlying the stay and/or frontal portion of the military hat.

Abstract: A furniture cover is provided that has a substantially t-shaped, substantially continuous, fabric body having a generally elongated central trunk portion, and two outwardly extending arm portions. The central trunk portion is sized to extend over and substantially across the back, seat and front of a seating device. The arm portions are sized to extend over and substantially across the arms of the seating device. The fabric body has a first layer of comfort fabric for exposure to the user; and a second layer of waterproof fabric, seamed around a perimeter edge to the first layer, so that the second layer provides a waterproof barrier across the covered portions of the seating device.

Abstract: A method for treating, preventing or ameliorating breast cancer is provided by administering a synergistic amount of digitoxin and either actein or an extract of black cohosh comprising triterpene glycosides, and optionally another chemopreventive agent which may be paclitaxel. Methods for treating or preventing a neoplasia using a synergistic combination, and compositions of a synergistic combination of a cardiac glycoside and either actein or an extract of black cohosh comprising triterpene glycosides, and optionally another chemopreventive agent which may be a taxane are also provided. The compositions may also be used in a method for modulating Na+K+ATPase activity. In addition, a method for inhibiting the progression or development of breast cancer in vivo by administering either actein or an extract of black cohosh comprising triterpene glycosides and optionally at least one other chemoprotective agent is provided.

Abstract: A method is provided for treating, preventing or ameliorating neoplasia in a subject. This method includes administering to the subject an amount of actein or an amount of an extract of black cohosh that contains a triterpene glycoside, which amount of the actein or black cohosh is effective to treat, prevent or ameliorate the neoplasia, in combination with an amount of a statin which is effective to treat, prevent, or ameliorate the neoplasia. Related methods for treating, preventing or ameliorating breast cancer, or liver cell neoplasia are also provided. In addition, methods for modulating a cholesterol biosynthesis pathway and a stress response pathway in a subject are provided. These methods include administering to a subject a composition comprising an anti-neoplastic synergistic amount of a statin and actein. Compositions for carrying out such methods are also provided.

Abstract: The present invention provides a composition for use in treating or preventing neoplasia, comprising an effective actein. The present invention also provides a composition for use in treating or preventing neoplasia, comprising an effective anti-neoplastic amount of an ethyl acetate extract of black cohosh. The present invention further provides a combination of anti-neoplastic agents, comprising an effective anti-neoplastic amount of an ethyl acetate extract of black cohosh and an effective anti-neoplastic amount of at least one additional chemopreventive or chemotherapeutic agent. Methods for treating and preventing neoplasia are also provided.

Abstract: A method is provided for treating, preventing or ameliorating neoplasia in a subject. This method includes administering to the subject an amount of actein or an amount of an extract of black cohosh that contains a triterpene glycoside, which amount of the actein or black cohosh is effective to treat, prevent or ameliorate the neoplasia, in combination with an amount of a statin which is effective to treat, prevent, or ameliorate the neoplasia. Related methods for treating, preventing or ameliorating breast cancer, or liver cell neoplasia are also provided. In addition, methods for modulating a cholesterol biosynthesis pathway and a stress response pathway in a subject are provided. These methods include administering to a subject a composition comprising an anti-neoplastic synergistic amount of a statin and actein. Compositions for carrying out such methods are also provided.

Abstract: A method for treating, preventing or ameliorating breast cancer is provided by administering a synergistic amount of digitoxin and either actein or an extract of black cohosh comprising triterpene glycosides, and optionally another chemopreventive agent which may be paclitaxel. Methods for treating or preventing a neoplasia using a synergistic combination, and compositions of a synergistic combination of a cardiac glycoside and either actein or an extract of black cohosh comprising triterpene glycosides, and optionally another chemopreventive agent which may be a taxane are also provided. The compositions may also be used in a method for modulating Na+K+ATPase activity. In addition, a method for inhibiting the progression or development of breast cancer in vivo by administering either actein or an extract of black cohosh comprising triterpene glycosides and optionally at least one other chemoprotective agent is provided.

Abstract: The present invention provides a composition for use in treating or preventing neoplasia, comprising an effective actein. The present invention also provides a composition for use in treating or preventing neoplasia, comprising an effective anti-neoplastic amount of an ethyl acetate extract of black cohosh. The present invention further provides a combination of anti-neoplastic agents, comprising an effective anti-neoplastic amount of an ethyl acetate extract of black cohosh and an effective anti-neoplastic amount of at least one additional chemopreventive or chemotherapeutic agent. Methods for treating and preventing neoplasia are also provided.

Abstract: The present invention provides a composition for use in treating or preventing neoplasia, comprising an effective actein. The present invention also provides a composition for use in treating or preventing neoplasia, comprising an effective anti-neoplastic amount of an ethyl acetate extract of black cohosh. The present invention further provides a combination of anti-neoplastic agents, comprising an effective anti-neoplastic amount of an ethyl acetate extract of black cohosh and an effective anti-neoplastic amount of at least one additional chemopreventive or chemotherapeutic agent. Methods for treating and preventing neoplasia are also provided.

Abstract: A system for providing notification of market information which includes a user computer for specifying a market condition to be monitored, and an electronic source of updated market data is provided. The system also includes a host computer system for receiving and storing the specified market condition to be monitored. Upon receipt of the specified market condition to be monitored, the host computer system generates and transmits confirmation data to the user computer. A monitoring program executable on the host computer system compares the specified market condition and the source of updated market data to determine if the specified market condition is found to exist. If found to exist, the monitoring program generates a signal. A transmitter responsive to the signal generated by the monitoring program transmits notification of the specified market condition.

Abstract: A system and method are provided for managing financial market information. According to certain embodiments, the system includes a computer having a memory, processor, and display. The processor is capable of generating a graphical depiction of the financial market information on the display. The graphical depiction includes a multidimensional representation of a broad range of market information for at least two financial instruments. The graphical depiction resides in a single window on the display. The financial instruments may include multiple different classes of financial instruments, such as treasuries and futures. Different instruments may be selected and information, including basis information, relevant to the selected instruments may be displayed in a second window.

Abstract: This invention provides a method to identify compounds potentially useful for the treatment and prevention of neoplasia in mammals. The phosphodiesterase inhibitory activity of a compound is determined along with its ability to elevate JNK kinase activity. Growth inhibitory and apoptosis inducing effects on cultured tumor cells are also determined. Compounds that exhibit phosphodiesterase inhibition, an ability to elevate JNK kinase activity, growth inhibition and apoptosis induction are desirable for the treatment of neoplasia.

Abstract: Methods and compositions for the prevention and/or treatment of cardiovascular diseases, the methods comprising administering to individuals in need thereof, an effective amount of a non-steroidal anti-inflammatory drug alone or in combination with other conventional therapies to induce apoptosis, reduce proliferation, induce quiescence, inhibit cell migration, or influence cell differentiation of the cells in the vascular wall and or/induce hypolipidemia.

Abstract: A biologically pure culture of a microorganism is provided designated SH2A and deposited under ATCC Accession No. 55926, or a mutant derived therefrom. Further provided is a biologically pure culture of a microorganism designated SH2B and deposited under ATCC Accession No. 202050, or a mutant derived therefrom. A method of degrading an organic material is carried out by treating the organic material with an effective, degrading amount of either SH2A or a mutant derived therefrom, or SH2B or a mutant derived therefrom. The microorganism designated SH2A or a mutant derived therefrom, or SH2B or a mutant derived therefrom, is grown by culturing the microorganism at a temperature and in a medium effective to promote growth of the microorganism.

Abstract: This invention provides a DNA oligomer having the sequence 5'GGACATAGGCTGATCTCTTAGC3' (SEQ ID NO: 1) and which is complementary to Campylobacter pylori 16S ribosomal RNA sequences, for use as a probe to detect Campylobacter pylori.This invention also provides DNA oligomers having the sequences 5'GCGCAATCAGCGTCAGGTAATG3' (SEQ ID NO: 2) and 5'GCTAAGAGATCAGCCTATGTCCC3' (SEQ ID NO: 3) and which are complementary to certain Campylobacter pylori 16S ribosomal RNA sequences, for use as polymerase chain reaction primers for the detection of Campylobacter pylori.This invention also provides a method for producing species-specific bacterial or protozoan DNA oligomers encoding 16S ribosomal RNA by means of the polymerase chain reaction for use as species-specific probes and PCR primers, and methods for detection and identification of bacteria and protozoa.Further, this invention provides a DNA oligomer having the sequence 5'ACGGGCGGTGTGTGC3' (SEQ ID NO: 4).

Abstract: A method and apparatus for the total dispensing of the contents, e.g. insecticide, of a container, which comprises actuating a release valve by an actuator and placing at least the actuator in rotation about a vertical axis as the contents discharge.