Patents by Inventor Bernard Weinstein

Bernard Weinstein has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Patent number: 9486525
    Abstract: The present invention provides a composition for use in treating or preventing neoplasia, comprising an effective actein. The present invention also provides a composition for use in treating or preventing neoplasia, comprising an effective anti-neoplastic amount of an ethyl acetate extract of black cohosh. The present invention further provides a combination of anti-neoplastic agents, comprising an effective anti-neoplastic amount of an ethyl acetate extract of black cohosh and an effective anti-neoplastic amount of at least one additional chemopreventive or chemotherapeutic agent. Methods for treating and preventing neoplasia are also provided.
    Type: Grant
    Filed: August 12, 2011
    Date of Patent: November 8, 2016
    Assignee: The Research Foundation of the City University of New York
    Inventors: Linda Saxe Einbond, I. Bernard Weinstein
  • Patent number: 8733837
    Abstract: A furniture cover is provided that has a substantially t-shaped, substantially continuous, fabric body having a generally elongated central trunk portion, and two outwardly extending arm portions. The central trunk portion is sized to extend over and substantially across the back, seat and front of a seating device. The arm portions are sized to extend over and substantially across the arms of the seating device. The fabric body has a first layer of comfort fabric for exposure to the user; and a second layer of waterproof fabric, seamed around a perimeter edge to the first layer, so that the second layer provides a waterproof barrier across the covered portions of the seating device.
    Type: Grant
    Filed: January 20, 2012
    Date of Patent: May 27, 2014
    Assignee: Caber Sure Fit Inc.
    Inventors: Bernard Weinstein, Anita Aruajo, Karolin Belashkin, Nilvi Surrinder
  • Publication number: 20140101849
    Abstract: A liquid absorbing pad comprising a top layer and a bottom layer and an interior portion therebetween. The interior portion includes a liquid absorbing material. The top layer is made from microfiber bed sheet material. The bottom layer is made from microfiber terry, preferably non-oiled, the top of which is laminated with liquid-impermeable material. The top layer and interior portion are quilted together and glued to the bottom layer. When the pad is laid on a bed sheet made of microfiber bed sheet material extending horizontally, the pad resists horizontal movement relative to the bed sheet. The interior portion preferably may further includes a non-woven polypropylene layer below the liquid absorbing material so that the top layer, the liquid absorbing material and polypropylene layer are quilted together.
    Type: Application
    Filed: October 15, 2013
    Publication date: April 17, 2014
    Applicant: Caber Sure Fit Inc.
    Inventor: Bernard Weinstein
  • Publication number: 20130255041
    Abstract: A low-profile insect-proof closure is provided for an encasement of insect-impervious fabric. A zipper is provided for closing an opening in the encasement. The zipper is stitched to the encasement and has a zipper head, and a zipper track on a fabric zipper belt. A fabric backing panel is stitched to the encasement behind the zipper at a closure zone of the zipper. A finger-shaped insert is provided attached to the fabric backing panel. The insert, which is made of compressible elastomer, is arranged so as to physically block or apply pressure to the zipper head to keep the zipper head in closed position when the encasement is on the mattress. The insert has a width no greater than the width of the zipper belt and a thickness less than about 10 millimeters.
    Type: Application
    Filed: November 26, 2012
    Publication date: October 3, 2013
    Applicant: CABER SURE FIT, INC.
    Inventor: Bernard Weinstein
  • Publication number: 20130232664
    Abstract: A military or uniform hat comprising a frame having an annular headband and visor connected thereto. A stay is connected to the frame and extends outwardly, above the visor so as to at least partially define a frontal portion of the hat. The stay includes an elongated channel formed rearward of a front face of the stay and structured to enclose and support at least a portion of the length of a grommet used to support an at least partially configure a cover of the hat. The stay includes an at least partially smooth, substantially uninterrupted front surface and oppositely disposed open ends of the channel cooperatively configured to eliminate or significantly reduce the possibility of any unsightly deformations, protrusions, etc. observable on the portion of the cover overlying the stay and/or frontal portion of the military hat.
    Type: Application
    Filed: February 22, 2013
    Publication date: September 12, 2013
    Inventors: Lawrence C. Weinstein, Bernard Weinstein
  • Publication number: 20130187420
    Abstract: A furniture cover is provided that has a substantially t-shaped, substantially continuous, fabric body having a generally elongated central trunk portion, and two outwardly extending arm portions. The central trunk portion is sized to extend over and substantially across the back, seat and front of a seating device. The arm portions are sized to extend over and substantially across the arms of the seating device. The fabric body has a first layer of comfort fabric for exposure to the user; and a second layer of waterproof fabric, seamed around a perimeter edge to the first layer, so that the second layer provides a waterproof barrier across the covered portions of the seating device.
    Type: Application
    Filed: January 20, 2012
    Publication date: July 25, 2013
    Applicant: Caber Sure Fit Inc.
    Inventors: Bernard WEINSTEIN, Anita ARUAJO, Karolin BELASHKIN, Nilvi Surrinder
  • Publication number: 20120219643
    Abstract: A method for treating, preventing or ameliorating breast cancer is provided by administering a synergistic amount of digitoxin and either actein or an extract of black cohosh comprising triterpene glycosides, and optionally another chemopreventive agent which may be paclitaxel. Methods for treating or preventing a neoplasia using a synergistic combination, and compositions of a synergistic combination of a cardiac glycoside and either actein or an extract of black cohosh comprising triterpene glycosides, and optionally another chemopreventive agent which may be a taxane are also provided. The compositions may also be used in a method for modulating Na+K+ATPase activity. In addition, a method for inhibiting the progression or development of breast cancer in vivo by administering either actein or an extract of black cohosh comprising triterpene glycosides and optionally at least one other chemoprotective agent is provided.
    Type: Application
    Filed: April 5, 2012
    Publication date: August 30, 2012
    Inventors: Linda Saxe Einbond, Morando Soffritti, I. Bernard Weinstein, Joan Weinstein, Tamara Weinstein, Claudia Weinstein, Matthew Weinstein
  • Publication number: 20120208776
    Abstract: A method is provided for treating, preventing or ameliorating neoplasia in a subject. This method includes administering to the subject an amount of actein or an amount of an extract of black cohosh that contains a triterpene glycoside, which amount of the actein or black cohosh is effective to treat, prevent or ameliorate the neoplasia, in combination with an amount of a statin which is effective to treat, prevent, or ameliorate the neoplasia. Related methods for treating, preventing or ameliorating breast cancer, or liver cell neoplasia are also provided. In addition, methods for modulating a cholesterol biosynthesis pathway and a stress response pathway in a subject are provided. These methods include administering to a subject a composition comprising an anti-neoplastic synergistic amount of a statin and actein. Compositions for carrying out such methods are also provided.
    Type: Application
    Filed: April 5, 2012
    Publication date: August 16, 2012
    Inventors: Linda Saxe Einbond, Morando Soffritti, Kyle Louis Kolaja, Richard John Brennan, I. Bernard Weinstein, Joan Weinstein, Tamara Weinstein, Claudia Weinstein, Matthew Weinstein
  • Publication number: 20120034217
    Abstract: The present invention provides a composition for use in treating or preventing neoplasia, comprising an effective actein. The present invention also provides a composition for use in treating or preventing neoplasia, comprising an effective anti-neoplastic amount of an ethyl acetate extract of black cohosh. The present invention further provides a combination of anti-neoplastic agents, comprising an effective anti-neoplastic amount of an ethyl acetate extract of black cohosh and an effective anti-neoplastic amount of at least one additional chemopreventive or chemotherapeutic agent. Methods for treating and preventing neoplasia are also provided.
    Type: Application
    Filed: August 12, 2011
    Publication date: February 9, 2012
    Inventors: Linda Saxe EINBOND, I. Bernard Weinstein
  • Publication number: 20090264377
    Abstract: A method is provided for treating, preventing or ameliorating neoplasia in a subject. This method includes administering to the subject an amount of actein or an amount of an extract of black cohosh that contains a triterpene glycoside, which amount of the actein or black cohosh is effective to treat, prevent or ameliorate the neoplasia, in combination with an amount of a statin which is effective to treat, prevent, or ameliorate the neoplasia. Related methods for treating, preventing or ameliorating breast cancer, or liver cell neoplasia are also provided. In addition, methods for modulating a cholesterol biosynthesis pathway and a stress response pathway in a subject are provided. These methods include administering to a subject a composition comprising an anti-neoplastic synergistic amount of a statin and actein. Compositions for carrying out such methods are also provided.
    Type: Application
    Filed: October 21, 2008
    Publication date: October 22, 2009
    Inventors: Linda Saxe Einbond, Morando Soffritti, Kyle Louis Kolaja, Richard John Brennan, I. Bernard Weinstein, Joan Weinstein, Tamara Weinstein, Claudia Weinstein, Matthew Weinstein
  • Publication number: 20090186837
    Abstract: A method for treating, preventing or ameliorating breast cancer is provided by administering a synergistic amount of digitoxin and either actein or an extract of black cohosh comprising triterpene glycosides, and optionally another chemopreventive agent which may be paclitaxel. Methods for treating or preventing a neoplasia using a synergistic combination, and compositions of a synergistic combination of a cardiac glycoside and either actein or an extract of black cohosh comprising triterpene glycosides, and optionally another chemopreventive agent which may be a taxane are also provided. The compositions may also be used in a method for modulating Na+K+ATPase activity. In addition, a method for inhibiting the progression or development of breast cancer in vivo by administering either actein or an extract of black cohosh comprising triterpene glycosides and optionally at least one other chemoprotective agent is provided.
    Type: Application
    Filed: August 13, 2008
    Publication date: July 23, 2009
    Inventors: Linda Saxe Einbond, Morando Soffritti, I. Bernard Weinstein, Joan Weinstein
  • Publication number: 20090075919
    Abstract: The present invention provides a composition for use in treating or preventing neoplasia, comprising an effective actein. The present invention also provides a composition for use in treating or preventing neoplasia, comprising an effective anti-neoplastic amount of an ethyl acetate extract of black cohosh. The present invention further provides a combination of anti-neoplastic agents, comprising an effective anti-neoplastic amount of an ethyl acetate extract of black cohosh and an effective anti-neoplastic amount of at least one additional chemopreventive or chemotherapeutic agent. Methods for treating and preventing neoplasia are also provided.
    Type: Application
    Filed: August 4, 2008
    Publication date: March 19, 2009
    Inventors: Linda Saxe Einbond, I. Bernard Weinstein
  • Patent number: 7407675
    Abstract: The present invention provides a composition for use in treating or preventing neoplasia, comprising an effective actein. The present invention also provides a composition for use in treating or preventing neoplasia, comprising an effective anti-neoplastic amount of an ethyl acetate extract of black cohosh. The present invention further provides a combination of anti-neoplastic agents, comprising an effective anti-neoplastic amount of an ethyl acetate extract of black cohosh and an effective anti-neoplastic amount of at least one additional chemopreventive or chemotherapeutic agent. Methods for treating and preventing neoplasia are also provided.
    Type: Grant
    Filed: December 23, 2003
    Date of Patent: August 5, 2008
    Assignee: The Trustees of Columbia University in the City of New York
    Inventors: Linda Saxe Einbond, I. Bernard Weinstein
  • Publication number: 20070061452
    Abstract: A system for providing notification of market information which includes a user computer for specifying a market condition to be monitored, and an electronic source of updated market data is provided. The system also includes a host computer system for receiving and storing the specified market condition to be monitored. Upon receipt of the specified market condition to be monitored, the host computer system generates and transmits confirmation data to the user computer. A monitoring program executable on the host computer system compares the specified market condition and the source of updated market data to determine if the specified market condition is found to exist. If found to exist, the monitoring program generates a signal. A transmitter responsive to the signal generated by the monitoring program transmits notification of the specified market condition.
    Type: Application
    Filed: November 13, 2006
    Publication date: March 15, 2007
    Applicant: The Thomson Corporation
    Inventors: Bernard Weinstein, Steven Bongiovanni, Kevin Flynn
  • Publication number: 20070038543
    Abstract: A system and method are provided for managing financial market information. According to certain embodiments, the system includes a computer having a memory, processor, and display. The processor is capable of generating a graphical depiction of the financial market information on the display. The graphical depiction includes a multidimensional representation of a broad range of market information for at least two financial instruments. The graphical depiction resides in a single window on the display. The financial instruments may include multiple different classes of financial instruments, such as treasuries and futures. Different instruments may be selected and information, including basis information, relevant to the selected instruments may be displayed in a second window.
    Type: Application
    Filed: June 20, 2006
    Publication date: February 15, 2007
    Inventor: Bernard Weinstein
  • Patent number: 6569638
    Abstract: This invention provides a method to identify compounds potentially useful for the treatment and prevention of neoplasia in mammals. The phosphodiesterase inhibitory activity of a compound is determined along with its ability to elevate JNK kinase activity. Growth inhibitory and apoptosis inducing effects on cultured tumor cells are also determined. Compounds that exhibit phosphodiesterase inhibition, an ability to elevate JNK kinase activity, growth inhibition and apoptosis induction are desirable for the treatment of neoplasia.
    Type: Grant
    Filed: March 3, 2000
    Date of Patent: May 27, 2003
    Assignee: Cell Pathways, Inc
    Inventors: I. Bernard Weinstein, W. Joseph Thompson, Jae-Won Soh, Li Liu, Han Li
  • Patent number: 6201028
    Abstract: Methods and compositions for the prevention and/or treatment of cardiovascular diseases, the methods comprising administering to individuals in need thereof, an effective amount of a non-steroidal anti-inflammatory drug alone or in combination with other conventional therapies to induce apoptosis, reduce proliferation, induce quiescence, inhibit cell migration, or influence cell differentiation of the cells in the vascular wall and or/induce hypolipidemia.
    Type: Grant
    Filed: December 8, 1998
    Date of Patent: March 13, 2001
    Assignees: The Rockefeller University, Mt. Sinai School of Medicine, Columbia University
    Inventors: Steven Shiff, Edward A. Fisher, I. Bernard Weinstein, Hayes M. Dansky, Urnani Reiss
  • Patent number: 6190903
    Abstract: A biologically pure culture of a microorganism is provided designated SH2A and deposited under ATCC Accession No. 55926, or a mutant derived therefrom. Further provided is a biologically pure culture of a microorganism designated SH2B and deposited under ATCC Accession No. 202050, or a mutant derived therefrom. A method of degrading an organic material is carried out by treating the organic material with an effective, degrading amount of either SH2A or a mutant derived therefrom, or SH2B or a mutant derived therefrom. The microorganism designated SH2A or a mutant derived therefrom, or SH2B or a mutant derived therefrom, is grown by culturing the microorganism at a temperature and in a medium effective to promote growth of the microorganism.
    Type: Grant
    Filed: November 26, 1997
    Date of Patent: February 20, 2001
    Assignee: The Trustees of Columbia University in the City of New York
    Inventors: I. Bernard Weinstein, David Figurski, Sadayori Hoshina, Koji Nakanishi
  • Patent number: 5571674
    Abstract: This invention provides a DNA oligomer having the sequence 5'GGACATAGGCTGATCTCTTAGC3' (SEQ ID NO: 1) and which is complementary to Campylobacter pylori 16S ribosomal RNA sequences, for use as a probe to detect Campylobacter pylori.This invention also provides DNA oligomers having the sequences 5'GCGCAATCAGCGTCAGGTAATG3' (SEQ ID NO: 2) and 5'GCTAAGAGATCAGCCTATGTCCC3' (SEQ ID NO: 3) and which are complementary to certain Campylobacter pylori 16S ribosomal RNA sequences, for use as polymerase chain reaction primers for the detection of Campylobacter pylori.This invention also provides a method for producing species-specific bacterial or protozoan DNA oligomers encoding 16S ribosomal RNA by means of the polymerase chain reaction for use as species-specific probes and PCR primers, and methods for detection and identification of bacteria and protozoa.Further, this invention provides a DNA oligomer having the sequence 5'ACGGGCGGTGTGTGC3' (SEQ ID NO: 4).
    Type: Grant
    Filed: April 14, 1994
    Date of Patent: November 5, 1996
    Assignee: The Trustees of Columbia University in the City of New York
    Inventors: Sadayori Hoshina, I. Bernard Weinstein
  • Patent number: 4568002
    Abstract: A method and apparatus for the total dispensing of the contents, e.g. insecticide, of a container, which comprises actuating a release valve by an actuator and placing at least the actuator in rotation about a vertical axis as the contents discharge.
    Type: Grant
    Filed: May 31, 1983
    Date of Patent: February 4, 1986
    Assignee: American Home Products Corporation (Del.)
    Inventors: Bernard Weinstein, William L. H. Hemsarth