Patents by Inventor Brett P. Monia

Brett P. Monia has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Modulation of diacylglycerol acyltransferase 1 expression
    Patent number: 7414033
    Abstract: Compounds, compositions and methods are provided for modulating the expression of diacylglycerol acyltransferase 1. The compositions comprise oligonucleotides, targeted to nucleic acid encoding diacylglycerol acyltransferase 1. Methods of using these compounds for modulation of diacylglycerol acyltransferase 1 expression and for diagnosis and treatment of disease associated with expression of diacylglycerol acyltransferase 1, such as obesity and obesity-related conditions, are provided.
    Type: Grant
    Filed: March 18, 2004
    Date of Patent: August 19, 2008
    Assignee: Isis Pharmaceuticals, Inc.
    Inventors: Brett P. Monia, Mark J. Graham
  • Antisense Modulation of P38 Mitogen Activated Protein Kinase Expression
    Publication number: 20080194503
    Abstract: Compositions and methods for the treatment and diagnosis of diseases or conditions amenable to treatment through modulation of expression of a gene encoding a p38 mitogen-activated protein kinase (p38 MAPK) are provided. Methods for decreasing airway hyperresponsiveness or airway inflammation in an animal are also provided.
    Type: Application
    Filed: August 12, 2004
    Publication date: August 14, 2008
    Inventors: Brett P. Monia, Kenneth W. Dobie, Susan M. Freier, Ian Popoff, Wai Shiu Fred Wong, James G. Karras
  • Antisense modulation of bcl-x expression
    Patent number: 7148204
    Abstract: Compositions and methods are provided for modulating the expression of bcl-x. Antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding bcl-x are preferred. Methods of using these compounds for modulation of bcl-x expression and for treatment of diseases associated with expression of bcl-x are also provided. Methods of sensitizing cells to apoptotic stimuli are also provided.
    Type: Grant
    Filed: November 21, 2002
    Date of Patent: December 12, 2006
    Assignee: Isis Pharmaceuticala, Inc.
    Inventors: C. Frank Bennett, Nicholas M. Dean, Brett P. Monia, Brian J. Nickoloff, Vivian Q. Zhang
  • Gapped oligonucleotides
    Patent number: 7015315
    Abstract: Oligonucleotides and other macromolecules are provided which have increased nuclease resistance, substituent groups for increasing binding affinity to complementary strand, and subsequences of 2?-deoxy-erythro-pentofuranosyl nucleotides that activate RNase H. Such oligonucleotides and macromolecules are useful for diagnostics and other research purposes, for modulating the expression of a protein in organisms, and for the diagnosis, detection and treatment of other conditions susceptible to oligonucleotide therapeutics.
    Type: Grant
    Filed: June 6, 1995
    Date of Patent: March 21, 2006
    Assignee: ISIS Pharmaceuticals, Inc.
    Inventors: Phillip Dan Cook, Brett P. Monia
  • TRPM-2 antisense therapy using an oligonucleotide having 2?-O-(2-methoxy)ethyl modifications
    Patent number: 6900187
    Abstract: A compound consisting of an oligonucleotide of sequence CAGCAGCAGAGTCTTCATCAT, where the oligonucleotide has a phosphorothioate backbone throughout, the sugar moieties of nucleotides 1-4 and 18-21 bear 2?-O-methoxyethyl modifications, and the remaining nucleotides (nucleotides 5-17) are 2?-deoxynucleotides, and where the cytosines of nucleotides 1, 4 and 19 are 5-methylcytosines. The compound has increased stability in vivo and improved in vitro and in vivo antitumor activity.
    Type: Grant
    Filed: February 22, 2002
    Date of Patent: May 31, 2005
    Assignee: The University of British Columbia
    Inventors: Martin Gleave, Paul S. Rennie, Hideaki Miyake, Colleen Nelson, Brett P. Monia
  • Antisense modulation of transforming growth factor-beta 3 expression
    Patent number: 6884787
    Abstract: Antisense compounds, compositions and methods are provided for modulating the expression of transforming growth factor-beta 3. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding transforming growth factor-beta 3. Methods of using these compounds for modulation of transforming growth factor-beta 3 expression and for treatment of diseases associated with expression of transforming growth factor-beta 3 are provided.
    Type: Grant
    Filed: July 14, 2001
    Date of Patent: April 26, 2005
    Assignee: ISIS Pharmaceuticals, Inc.
    Inventors: Brett P. Monia, Susan M. Freier
  • Antisense modulation of dual specific phosphatase 5 expression
    Patent number: 6867039
    Abstract: Antisense compounds, compositions and methods are provided for modulating the expression of dual specific phosphatase 5. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding dual specific phosphatase 5. Methods of using these compounds for modulation of dual specific phosphatase 5 expression and for treatment of diseases associated with expression of dual specific phosphatase 5 are provided.
    Type: Grant
    Filed: May 25, 2001
    Date of Patent: March 15, 2005
    Assignee: Isis Pharmaceuticals, Inc.
    Inventors: Brett P. Monia, Andrew T. Watt
  • Antisense oligonucleotide compositions and methods for the modulation of JNK proteins
    Patent number: 6809193
    Abstract: Compositions and methods for the treatment and diagnosis of diseases or disorders amenable to treatment through modulation of expression of a gene encoding a Jun N-terminal kinase (JNK protein) are provided. Oligonucleotide are herein provided which are specifically hybridizable with nucleic acids encoding JNK1, JNK2 and JNK3, as well as other JNK proteins and specific isoforms thereof. Methods of treating animals suffering from diseases or disorders amenable to therapeutic intervention by modulating the expression of one or more JNK proteins with such oligonucleotide are also provided. Methods for the treatment and diagnosis of diseases or disorders associated with aberrant expression of one or more JNK proteins are also provided. Methods for inducing apoptosis and for treating diseases or conditions associated with a reduction in apoptosis are also provided.
    Type: Grant
    Filed: January 31, 2001
    Date of Patent: October 26, 2004
    Assignee: ISIS Pharmaceuticals, Inc.
    Inventors: Robert McKay, Nicholas M. Dean, Brett P. Monia, Pamela Nero, William A. Gaarde
  • Modulation of diacylglycerol acyltransferase 1 expression
    Publication number: 20040209838
    Abstract: Compounds, compositions and methods are provided for modulating the expression of diacylglycerol acyltransferase 1. The compositions comprise oligonucleotides, targeted to nucleic acid encoding diacylglycerol acyltransferase 1. Methods of using these compounds for modulation of diacylglycerol acyltransferase 1 expression and for diagnosis and treatment of disease associated with expression of diacylglycerol acyltransferase 1, such as obesity and obesity-related conditions, are provided.
    Type: Application
    Filed: March 18, 2004
    Publication date: October 21, 2004
    Inventors: Brett P. Monia, Mark J. Graham
  • Antisense oligonucleotide modulation of raf gene expression
    Patent number: 6806258
    Abstract: Oligonucleotides are provided which are targeted to nucleic acids encoding human raf and capable of inhibiting raf expression. The oligonucleotides may have chemical modifications at one or more positions and may be chimeric oligonucleotides. Methods of inhibiting the expression of human raf using oligonucleotides of the invention are also provided. The present invention further comprises methods of inhibiting hyperproliferation of cells and methods of treating or preventing conditions, including hyperproliferative conditions, associated with raf expression.
    Type: Grant
    Filed: January 25, 2002
    Date of Patent: October 19, 2004
    Assignee: ISIS Pharmaceuticals, Inc.
    Inventor: Brett P. Monia
  • Antisense modulation of histone deacetylase I expression
    Publication number: 20040204373
    Abstract: Antisense compounds, compositions and methods are provided for modulating the expression of Histone deacetylase 1. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding Histone deacetylase 1. Methods of using these compounds for modulation of Histone deacetylase 1 expression and for treatment of diseases associated with expression of Histone deacetylase 1 are provided.
    Type: Application
    Filed: December 19, 2000
    Publication date: October 14, 2004
    Applicant: Isis Pharmaceuticals Inc.
    Inventors: Brett P. Monia, Jacqueline Wyatt
  • Antisense modulation of PKA regulatory subunit RII beta expession
    Publication number: 20040197906
    Abstract: Antisense compounds, compositions and methods are provided for modulating the expression of PKA regulatory subunit RII beta. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding PKA regulatory subunit RII beta. Methods of using these compounds for modulation of PKA regulatory subunit RII beta expression and for treatment of diseases associated with expression of PKA regulatory subunit RII beta are provided.
    Type: Application
    Filed: September 10, 2003
    Publication date: October 7, 2004
    Inventors: Brett P. Monia, Jacqueline Wyatt
  • Antisense modulation of focal adhesion kinase expression
    Publication number: 20040192628
    Abstract: Compounds, compositions and methods are provided for inhibiting FAK mediated signaling. The compositions comprise antisense compounds targeted to nucleic acids encoding FAK. Methods of using these antisense compounds for inhibition of FAK expression and for treatment of diseases, particularly cancers, associated with overexpression or constitutive activation of FAK are provided.
    Type: Application
    Filed: August 22, 2003
    Publication date: September 30, 2004
    Inventors: Brett P. Monia, William A. Gaarde, Pamela S. Nero
  • Modulation of diacylglycerol acyltransferase 1 expression
    Publication number: 20040185559
    Abstract: Compounds, compositions and methods are provided for modulating the expression of diacylglycerol acyltransferase 1. The compositions comprise oligonucleotides, targeted to nucleic acid encoding diacylglycerol acyltransferase 1. Methods of using these compounds for modulation of diacylglycerol acyltransferase 1 expression and for diagnosis and treatment of disease associated with expression of diacylglycerol acyltransferase 1 are provided.
    Type: Application
    Filed: March 21, 2003
    Publication date: September 23, 2004
    Applicant: Isis Pharmaceuticals Inc.
    Inventors: Brett P. Monia, Mark J. Graham
  • Antisense modulation of p38 mitogen activated protein kinase expression
    Publication number: 20040171566
    Abstract: Compositions and methods for the treatment and diagnosis of diseases or conditions amenable to treatment through modulation of expression of a gene encoding a p38 mitogen-activated protein kinase (p38 MAPK) are provided. Methods for the treatment and diagnosis of diseases or conditions associated with aberrant expression of one or more p38 MAPKs are also provided.
    Type: Application
    Filed: August 15, 2003
    Publication date: September 2, 2004
    Inventors: Brett P. Monia, William A. Gaarde, Pamela Nero, Robert McKay, Wai Shiu Fred Wong
  • Antisense oligonucleotide inhibition of ras
    Patent number: 6784290
    Abstract: Compositions and methods are provided for the modulation of ras expression. Oligonucleotides are provided which are targeted to nucleic acids encoding human ras. Oligonucleotides specifically hybridizable with mRNA encoding human H-ras, Ki-ras and N-ras are provided. Such oligonucleotides can be used for therapeutics and diagnostics as well as for research purposes. Methods are also disclosed for modulating ras gene expression in cells and tissues using the oligonucleotides provided, and for specific modulation of expression of activated ras. Methods for diagnosis, detection and treatment of conditions, or particular cancers, associated with ras are also disclosed.
    Type: Grant
    Filed: May 22, 2000
    Date of Patent: August 31, 2004
    Assignee: ISIS Pharmaceuticals, Inc.
    Inventors: Brett P. Monia, Lex M. Cowsert, Muthiah Manoharan
  • Antisense modulation of P70 S6 kinase expression
    Publication number: 20040147477
    Abstract: Antisense compounds, compositions and methods are provided for modulating the expression of p70 S6 kinase. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding p70 S6 kinase. Methods of using these compounds for modulation of p70 S6 kinase expression and for treatment of diseases associated with expression of p70 S6 kinase are provided.
    Type: Application
    Filed: March 8, 2004
    Publication date: July 29, 2004
    Inventors: Brett P. Monia, Lex M. Cowsert
  • Antisense modulation of TRADD expression
    Publication number: 20040137501
    Abstract: Antisense compounds, compositions and methods are provided for modulating the expression of TRADD. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding TRADD. Methods of using these compounds for modulation of TRADD expression and for treatment of diseases associated with expression of TRADD are provided.
    Type: Application
    Filed: January 26, 2004
    Publication date: July 15, 2004
    Inventors: Brett P. Monia, Lex M. Cowsert
  • Antisense modulation of dual specific phosphatase 6 expression
    Publication number: 20040127451
    Abstract: Antisense compounds, compositions and methods are provided for modulating the expression of dual specific phosphatase 6. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding dual specific phosphatase 6. Methods of using these compounds for modulation of dual specific phosphatase 6 expression and for treatment of diseases associated with expression of dual specific phosphatase 6 are provided.
    Type: Application
    Filed: February 9, 2004
    Publication date: July 1, 2004
    Inventors: Brett P. Monia, Lex M. Cowsert, Kenneth W. Dobie
  • Antisense modulation of protein phosphatase 2 Catalytic subunit alpha expression
    Publication number: 20040121973
    Abstract: Antisense compounds, compositions and methods are provided for modulating the expression of Protein Phosphatase 2 catalytic subunit alpha. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding Protein Phosphatase 2 catalytic subunit alpha. Methods of using these compounds for modulation of Protein Phosphatase 2 catalytic subunit alpha expression and for treatment of diseases associated with expression of Protein Phosphatase 2 catalytic subunit alpha are provided.
    Type: Application
    Filed: February 5, 2004
    Publication date: June 24, 2004
    Inventors: Brett P Monia, Jacqueline R Wyatt