Patents by Inventor Carol M. Troy
Carol M. Troy has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).
-
Patent number: 11857609Abstract: The present disclosure relates to a method for treating diabetic macular edema (DME) and/or retinal vein occlusion (RVO) comprising administering to the retina of a patient in need thereof an effective amount of a caspase-9 signaling pathway inhibitor. The caspase-9 signaling pathway inhibitor may include a peptide caspase-9 inhibitor and/or may be conjugated to a cell-penetrating peptide. The present disclosure further includes pharmaceutical compositions including a caspase-9 signaling pathway inhibitor. The disclosure further relates to the use of such compositions in a method for treating DME and/or RVO.Type: GrantFiled: November 30, 2021Date of Patent: January 2, 2024Assignee: The Trustees of Columbia University in the City of New YorkInventors: Carol M. Troy, Ying Y. Jean
-
Publication number: 20220387565Abstract: The present disclosure relates to a method for treating diabetic macular edema (DME) and/or retinal vein occlusion (RVO) comprising administering to the retina of a patient in need thereof an effective amount of a caspase-9 signaling pathway inhibitor. The caspase-9 signaling pathway inhibitor may include a peptide caspase-9 inhibitor and/or may be conjugated to a cell-penetrating peptide. The present disclosure further includes pharmaceutical compositions including a caspase-9 signaling pathway inhibitor. The disclosure further relates to the use of such compositions in a method for treating DME and/or RVO.Type: ApplicationFiled: November 30, 2021Publication date: December 8, 2022Inventors: Carol M. Troy, Ying Y. Jean
-
Publication number: 20220265767Abstract: A method of providing a high concentration disulfide-linked caspase inhibitor-cell penetrating peptide conjugate is described. The method includes incubating a caspase inhibitor having one or more thiol groups with a reducing agent selected from dithiothreitol (DTT), 2-mercaptoethanol (2-ME) and tris(2-carboxyethyl)phosphine (TCEP) to provide a reduced caspase inhibitor, removing the reducing agent from the reduced caspase inhibitor, and conjugating the reduced caspase inhibitor with a cell-penetrating peptide by a disulfide linkage.Type: ApplicationFiled: May 4, 2022Publication date: August 25, 2022Inventors: Carol M. Troy, Anna M. Potentski, Maria I. Avrutsky
-
Publication number: 20200164026Abstract: The present invention relates to compositions and methods for the inhibition of apoptosis associated with ischemic injury in the central nervous system. In addition, the present invention relates to compositions and methods useful for extending the therapeutic window associated with ischemic injury.Type: ApplicationFiled: January 9, 2020Publication date: May 28, 2020Inventors: Carol M. Troy, Nsikan Akpan, Guy S. Salvesen, Scott Snipas
-
Publication number: 20190142915Abstract: The present disclosure relates to a method for treating diabetic macular edema (DME) and/or retinal vein occlusion (RVO) comprising administering to the retina of a patient in need thereof an effective amount of a caspase-9 signaling pathway inhibitor. The caspase-9 signaling pathway inhibitor may include a peptide caspase-9 inhibitor and/or may be conjugated to a cell-penetrating peptide. The present disclosure further includes pharmaceutical compositions including a caspase-9 signaling pathway inhibitor. The disclosure further relates to the use of such compositions in a method for treating DME and/or RVO.Type: ApplicationFiled: January 9, 2019Publication date: May 16, 2019Inventors: Carol M. Troy, Ying Y. Jean
-
Patent number: 9376466Abstract: The present invention relates to compositions, including membrane permeable complexes, comprising a Caspase 2 activation inhibitory peptide having the amino acid sequence AFDAFC as well as methods of using the same for the treatment of neurodegenerative conditions associated with apoptosis in the central nervous system, such as Alzheimer's Disease, Mild Cognitive Impairment, Parkinson's Disease, amyotrophic lateral sclerosis, Huntington's chorea, and Creutzfeld-Jacob disease.Type: GrantFiled: March 7, 2014Date of Patent: June 28, 2016Assignee: THE TRUSTEES OF COLUMBIA UNIVERSITY IN THE CITY OF NEW YORKInventor: Carol M. Troy
-
Publication number: 20150165061Abstract: The present invention relates to compositions and methods for the inhibition of edema, including, but not limited to, edema associated with ischemic injury in the CNS. For example, in certain embodiments, the instant invention relates to methods and compositions for the inhibition of caspase-9 activity associated with the induction and/or exacerbation of edema.Type: ApplicationFiled: December 12, 2014Publication date: June 18, 2015Applicant: THE TRUSTEES OF COLUMBIA UNIVERSITY IN THE CITY OF NEW YORKInventors: Carol M. Troy, Nsikan E. Akpan
-
Publication number: 20150148302Abstract: The present invention relates to compositions, including membrane permeable complexes, comprising a Caspase 2 activation inhibitory peptide having the amino acid sequence AFDAFC as well as methods of using the same for the treatment of neurodegenerative conditions associated with apoptosis in the central nervous system, such as Alzheimer's Disease, Mild Cognitive Impairment, Parkinson's Disease, amyotrophic lateral sclerosis, Huntington's chorea, and Creutzfeld-Jacob disease.Type: ApplicationFiled: March 7, 2014Publication date: May 28, 2015Applicant: The Trustees of Columbia University in the city of New YorkInventor: Carol M. Troy
-
Publication number: 20090280058Abstract: The present invention provides for compositions and methods for in vivo delivery of a cell-permeable complex to cells of the central nervous system, wherein the cell-permeable complex decreases the level of a functional target protein encoded by a target mRNA molecule. In preferred embodiments of the invention, the cell-permeable complex comprises an siRNA nucleic acid molecule operably linked to a cell-penetrating peptide, wherein the cell-penetrating peptide facilitates transport of the cell-permeable complex across both the blood brain barrier and cell membrane of a target cell. The methods of the invention further encompass the utilization of convection-enhanced delivery methods such as intracerebral clysis (ICC) to deliver the cell-permeable complex to the target cells of the central nervous system.Type: ApplicationFiled: March 4, 2009Publication date: November 12, 2009Inventors: Carol M. Troy, Sander E. Connolly, Giselle F. Prunell, Andrew F. Ducruet
-
Patent number: 7223856Abstract: The present invention provides for an antisense oligonucleotide having the sequence 5?GCTCGGCGCCGCCATTTCCAG3?. The invention also provides for an antisense oligonucleotide having the sequence 5?GTCAGCGGCCATCAGCTT3?. The present invention further provides for a method for treating a neurodegenerative disorder in a subject which comprises administering to the subject a compound in an amount effective to inhibit neuronal cell death and thus treat the neurodegenerative disorder in the subject, which compound comprises the oligonucleotide 5?GCTCGGCGCCGCCATTTCCAG3? and a delivery agent. The present invention provides for a method of inhibiting trophic factor withdrawal mediated death of a cell which comprises contacting the cell with an amount of the oligonucleotide 5?GCTCGGCGCCGCCATTTCCAG3? effective to inhibit death of the cell.Type: GrantFiled: June 28, 2002Date of Patent: May 29, 2007Assignee: The Trustees of Columbia University in the City of New YorkInventors: Carol M. Troy, Michael L. Shelanski
-
Patent number: 7125956Abstract: The present invention provides for a compound having the structure: (AA1)n-Cys-(AA2)m wherein n=0,1,2,3,4 or 5 and m=0,1,2,3,4 or 5, provided the sum of (n+m) is greater than or equal to two and less than or equal to five, if n=1, (AA1)n=Ala-, if n=2, (AA1)n=Gln-Ala-, if n?3, (AA1)n=(Xaa)p-Gln-Ala-, and Xaa=any amino acid and wherein if n=n3, p=1, if n=4, p=2, if n=5, p=3, if m=1, (AA2)m=-Arg, if m=2, (AA2)m=-Arg-Gly, if m?3, (AA2)m=-Arg-Gly-(Xaa)q, wherein if m=3, q=1, if m=4, q=2, if m=5, q=3. The present invention provides for a method of inhibiting cell death and a method for alleviating symptoms of a neurodegenerative disorder in a subject.Type: GrantFiled: September 19, 2003Date of Patent: October 24, 2006Assignee: The Trustees of Columbia University in the City of New YorkInventor: Carol M. Troy
-
Publication number: 20040254136Abstract: This invention provides a first nucleic acid which specifically hybridizes to a nucleic acid encoding an inhibitor-of-apoptosis protein. This invention also provides related compositions and methods for inducing cell death and treating cancer using same. This invention further provides a second nucleic acid which specifically hybridizes to a nucleic acid encoding a protein, other than caspase-2, that induces cell death. Finally, this invention provides related compositions and methods for inhibiting cell death, inhibiting neuronal cell death in particular, and treating a neurodegenerative disorder and a heart disorder using the second nucleic acid.Type: ApplicationFiled: July 26, 2004Publication date: December 16, 2004Inventors: Carol M. Troy, Michael L. Shelanski
-
Patent number: 6794126Abstract: The present invention provides for a compound having the structure: (AA1)n-Cys-(AA2)m wherein n=0, 1, 2, 3, 4 or 5 and m=0, 1, 2, 3, 4 or 5, provided the sum of (n+m) is greater than or equal to two and less than or equal to five, if n=1, (AA1)n=Ala-, if n=2, (AA1)n=Gln-Ala-, if n≧3, (AA1)n=(Xaa)p-Gln-Ala-, and Xaa=any amino acid and wherein if n=n3, p=1, if n=4, p=2, if n=5, p=3, if m=1, (AA2)m=-Arg, if m=2, (AA2)m=-Arg-Gly, if m≧3, (AA2)m=-Arg-Gly-(Xaa)q, wherein if m=3, q=1, if m=4, q=2, if m=5, q=3. The present invention provides for a method of inhibiting cell death and a method for alleviating symptoms of a neurodegenerative disorder in a subject.Type: GrantFiled: September 4, 1998Date of Patent: September 21, 2004Assignee: The Trustees of Columbia University in the City of New YorkInventor: Carol M. Troy
-
Publication number: 20040147027Abstract: The present invention provides a membrane-permeable complex for facilitating the delivery of a double-stranded ribonucleic acid molecule into a cell. Specifically, the invention provides a membrane-permeable complex that comprises a double-stranded ribonucleic acid molecule, such as a small interfering RNA, a cell-penetrating peptide, and a covalent bond linking the double-stranded ribonucleic acid to the cell-penetrating peptide. Also provided are methods of using the membrane-permeable complex of the present invention to deliver the double-stranded ribonucleic acid molecule to a cell or to inhibit expression of a gene product by a cell.Type: ApplicationFiled: January 28, 2003Publication date: July 29, 2004Inventors: Carol M. Troy, Lloyd A. Greene
-
Patent number: 6635738Abstract: The present invention provides for a compound having the structure: (AA1)n-Cys-(AA2)m wherein n=0,1,2,3,4 or 5 and m=0,1,2,3,4 or 5, provided the sum of (n+m) is greater than or equal to two and less than or equal to five, if n=1, (AA1)n=Ala-, if n=2, (AA1)n=Gln-Ala-, if n≧3, (AA1)n=(Xaa)p-Gln-Ala-, and Xaa=any amino acid and wherein if n=n3, p=1, if n=4, p=2, if n=5, p=3, if m=1, (AA2)m=-Arg, if m=2, (AA2)m=-Arg-Gly, if m≧3, (AA2)m=-Arg-Gly-(Xaa)q, wherein if m=3, q=1, if m=4, q=2, if m=5, q=3. The present invention provides for a method of inhibiting cell death and a method for alleviating symptoms of a neurodegenerative disorder in a subject.Type: GrantFiled: March 4, 1996Date of Patent: October 21, 2003Assignee: The Trustees of Columbia University in the City of New YorkInventor: Carol M. Troy
-
Publication number: 20030092659Abstract: The present invention provides for an antisense oligonucleotide having the sequence 5′GCTCGGCGCCGCCATTTCCAG3′. The invention also provides for an antisense oligonucleotide having the sequence 5′GTCAGCGGCCATCAGCTT3′. The present invention further provides for a method for treating a neurodegenerative disorder in a subject which comprises administering to the subject a compound in an amount effective to inhibit neuronal cell death and thus treat the neurodegenerative disorder in the subject, which compound comprises the oligonucleotide 5′GCTCGGCGCCGCCATTTCCAG3′ and a delivery agent. The present invention provides for a method of inhibiting trophic factor withdrawal mediated death of a cell which comprises contacting the cell with an amount of the oligonucleotide 5′GCTCGGCGCCGCCATTTCCAG3′ effective to inhibit death of the cell.Type: ApplicationFiled: June 28, 2002Publication date: May 15, 2003Inventors: Carol M. Troy, Michael L. Shelanski
-
Patent number: 5929042Abstract: The present invention provides for an antisense oligonucleotide having the sequence 5'GCTCGGCGCCGCCATTTCCAG3'(SEQ ID NO:1). The invention also provides for an antisense oligonucleotide having the sequence 5'GTCAGCGGCCATCAGCTT3'(SEQ ID NO:2). The present invention further provides for a method for treating a neurodegenerative disorder in a subject which comprises administering to the subject a compound in an amount effective to inhibit neuronal cell death and thus treat the neurodegenerative disorder in the subject, which compound comprises the oligonucleotide 5'GCTCGGCGCCGCCATTTCCAG3' (SEQ ID NO:1) and a delivery agent. The present invention provides for a method of inhibiting trophic factor withdrawal mediated death of a cell which comprises contacting the cell with an amount of the oligonucleotide 5'GCTCGGCGCCGCCATTTCCAG3' (SEQ ID NO:1) effective to inhibit death of the cell.Type: GrantFiled: March 3, 1997Date of Patent: July 27, 1999Assignee: The Trustees of Columbia University in the City of New YorkInventors: Carol M. Troy, Michael L. Shelanski