Abstract: A genetically modified vertebrate is provided that has an enhanced sense due to an over representation of a predetermined odorant receptor. The vertebrate is genetically modified by introduction of DNA that comprises at least four sequential repeats of a sequence whose primary structure is at least 90% homologous with ACATAACTTTTTAATGAGTCT (SEQ ID NO: 1). The DNA causes a nearby odorant receptor coding sequence to be over represented in a singular gene choice fashion relative to a corresponding vertebrate that lacks the DNA.

Abstract: Provided herein are biosensors and methods for detecting one or more odorants associated with the levels, or a change in the levels, of one or more neurotransmitters in the central nervous system of a subject. In embodiments, provided are biosensors that comprise one or more populations of olfactory neurons, or cilia derived therefrom, wherein each population preferentially expresses a specific odorant receptor (OR). Also provided are biosensors comprising a cell or a population of cells engineered to express certain ORs; biosensors comprising certain isolated ORs; transgenic animals and tissues derived therefrom that preferentially express certain ORs; isolated cells or populations of cells engineered to express certain ORs; expression constructs for the preferential expression of certain ORs; and methods of using the biosensors, transgenic animals, tissues, cells, population of cells, and expression constructs disclosed herein.

Abstract: The present invention relates to the method of treating heavy menstrual bleeding in a subject with or without uterine fibroids and in need of treatment by administering an effective amount of 4-((R)-2-[5-(2-fluoro-3-methoxy-phenyl)-3-(2-fluoro-6-trifluoromethyl-benzyl)-4-methyl-2,6-dioxo-3,6-dihydro-2H-pyrimidin-1-yl]-1-phenyl-ethylamino)-butyric acid or a pharmaceutically acceptable salt thereof, in combination with estrogens and progestogens.

Abstract: The present disclosure relates to pharmaceutical compositions comprising a gonadotropin-releasing hormone (GnRH) antagonist and methods of preparing and using such compositions. The disclosure also relates to methods of facilitating release of a GnRH antagonist from a pharmaceutical composition.

Abstract: A biosensor for detecting trinitrotoluene (TNT) is disclosed. The biosensor has cells, such as olfactory sensory neurons (or cilia derived therefrom), that preferentially express a TNT-responsive odorant receptor protein.

Abstract: The present invention relates to the method of treating heavy menstrual bleeding in a subject with or without uterine fibroids and in need of treatment by administering an effective amount of 4-((R)-2-[5-(2-fluoro-3-methoxy-phenyl)-3-(2-fluoro-6-trifluoromethyl-benzyl)-4-methyl-2,6-dioxo-3,6-dihydro-2H-pyrimidin-1-yl]-1-phenyl-ethylamino)-butyric acid or a pharmaceutically acceptable salt thereof, in combination with estrogens and progestogens.

Abstract: The present disclosure relates to semiconductor structures and, more particularly, to a spacer with laminate liner and methods of manufacture. The structure includes: a replacement metal gate structure; a laminate low-k liner on the replacement metal gate structure; and a spacer on the laminate low-k liner.

Abstract: The present disclosure relates to semiconductor structures and, more particularly, to a spacer with laminate liner and methods of manufacture. The structure includes: a replacement metal gate structure; a laminate low-k liner on the replacement metal gate structure; and a spacer on the laminate low-k liner.

Abstract: A genetically modified vertebrate is provided that has an enhanced sense due to an over representation of a predetermined odorant receptor. The vertebrate is genetically modified by introduction of DNA that comprises at least four sequential repeats of a sequence whose primary structure is at least 90% homologous with ACATAACTTTTTAATGAGTCT (SEQ ID NO: 1). The DNA causes a nearby odorant receptor coding sequence to be over represented in a singular gene choice fashion relative to a corresponding vertebrate that lacks the DNA.

Abstract: A genetically modified vertebrate is provided that has an enhanced sense due to an over representation of a predetermined odorant receptor. The vertebrate is genetically modified by introduction of DNA that comprises at least four sequential repeats of a sequence whose primary structure is at least 90% homologous with ACATAACTTTTTAATGAGTCT (SEQ ID NO: 1). The DNA causes a nearby odorant receptor coding sequence to be over represented in a singular gene choice fashion relative to a corresponding vertebrate that lacks the DNA.

Abstract: A biosensor for detecting trinitrotoluene (TNT) is disclosed. The biosensor has cells, such as olfactory sensory neurons (or cilia derived therefrom), that preferentially express a TNT-responsive odorant receptor protein.

Abstract: The present disclosure relates to pharmaceutical compositions comprising a gonadotropin-releasing hormone (GnRH) antagonist and methods of preparing and using such compositions. The disclosure also relates to methods of facilitating release of a GnRH antagonist from a pharmaceutical composition.

Abstract: The present disclosure relates to pharmaceutical compositions comprising a gonadotropin-releasing hormone (GnRH) antagonist and methods of preparing and using such compositions. The disclosure also relates to methods of facilitating release of a GnRH antagonist from a pharmaceutical composition.

Abstract: A genetically modified vertebrate is provided that has an enhanced sense due to an over representation of a predetermined odorant receptor. The vertebrate is genetically modified by introduction of DNA that comprises at least four sequential repeats of a sequence whose primary structure is at least 90% homologous with ACATAACTTTTTAATGAGTCT (SEQ ID NO: 1). The DNA causes a nearby odorant receptor coding sequence to be over represented in a singular gene choice fashion relative to a corresponding vertebrate that lacks the DNA.

Abstract: A method of manufacturing multiple finFET devices having different thickness gate oxides. The method may include depositing a first dielectric layer on top of the semiconductor substrate, on top of a first fin, and on top of a second fin; forming a first dummy gate stack; forming a second dummy gate stack; removing the first and second dummy gates selective to the first and second gate oxides; masking a portion of the semiconductor structure comprising the second fin, and removing the first gate oxide from atop the first fin; and depositing a second dielectric layer within the first opening, and within the second opening, the second dielectric layer being located on top of the first fin and adjacent to the exposed sidewalls of the first pair of dielectric spacers, and on top of the second gate oxide and adjacent to the exposed sidewalls of the second pair of dielectric spacers.

Abstract: A method of manufacturing multiple finFET devices having different thickness gate oxides. The method may include depositing a first dielectric layer on top of the semiconductor substrate, on top of a first fin, and on top of a second fin; forming a first dummy gate stack; forming a second dummy gate stack; removing the first and second dummy gates selective to the first and second gate oxides; masking a portion of the semiconductor structure comprising the second fin, and removing the first gate oxide from atop the first fin; and depositing a second dielectric layer within the first opening, and within the second opening, the second dielectric layer being located on top of the first fin and adjacent to the exposed sidewalls of the first pair of dielectric spacers, and on top of the second gate oxide and adjacent to the exposed sidewalls of the second pair of dielectric spacers.

Abstract: Described herein are substrates coated with crystals having uniform crystalline morphology on the surface of the substrate. The coated substrates are useful in culturing and performing functional assays on cells such as, for example, resorption studies on bone cells. New methods for producing such coated substrates are also disclosed.

Abstract: A semiconductor gate stack comprising a silicon oxide based gate dielectric and a doped semiconductor material is formed on a semiconductor substrate. A high-k material metal gate electrode comprising a high-k gate dielectric and a metal gate portion is also formed on the semiconductor substrate. Oxygen-impermeable dielectric spacers are formed on the sidewalls of the semiconductor gate stack and the high-k material metal gate stack. The oxygen-impermeable dielectric spacer on the semiconductor gate stack is removed, while the oxygen impermeable dielectric spacer on the high-k material metal gate electrode is preserved. A low-k dielectric spacer is formed on the semiconductor gate stack, which provides a low parasitic capacitance for the device employing the semiconductor gate stack.

Abstract: A semiconductor gate stack comprising a silicon oxide based gate dielectric and a doped semiconductor material is formed on a semiconductor substrate. A high-k material metal gate electrode comprising a high-k gate dielectric and a metal gate portion is also formed on the semiconductor substrate. Oxygen-impermeable dielectric spacers are formed on the sidewalls of the semiconductor gate stack and the high-k material metal gate stack. The oxygen-impermeable dielectric spacer on the semiconductor gate stack is removed, while the oxygen impermeable dielectric spacer on the high-k material metal gate electrode is preserved. A low-k dielectric spacer is formed on the semiconductor gate stack, which provides a low parasitic capacitance for the device employing the semiconductor gate stack.

Abstract: A method and structure for fabricating a dual damascene copper interconnect which electrically contacts a damascene tungsten wiring level. The method forms a first layer on a semiconductor substrate, a silicon nitride layer on the first layer, and a silicon dioxide layer on the silicon nitride layer. The first layer includes damascene tungsten interconnect regions separated by insulative dielectric material. A continuous space is formed by etching two contact troughs through the silicon dioxide and silicon nitride layers to expose damascene tungsten interconnect regions, and by etching a top portion of the silicon dioxide layer between the two contact troughs. A reduced-height portion of the silicon dioxide layer remains between the two contact troughs. The continuous space is filled with damascene copper. The resulting dual damascene copper interconnect electrically contacts the exposed damascene tungsten interconnect regions.