Patents by Inventor Chen-Chung Lin

Chen-Chung Lin has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • MicroRNAs 206 and 21 cooperate to promote RAS-extracellular signal-regulated kinase signaling by suppressing the translation of RASA1 and SPRED1
    Patent number: 10221415
    Abstract: The present invention provides a method for inhibiting the RAS-ERK pathway by upregulation of RASA1 and SPRED1 mRNAs in tumor cells by anti-miR treatment. The method includes wherein an anti-miR-206 binds to a nucleotide comprising the sequence UAGCUUAUCAGACU (SEQ ID NO: 21), or to a nucleotide comprising the sequence UGGAAUGUAAGGAAGUGUGUGG (SEQ ID NO: 9). A method of re-expression of RAS-ERK pathway inhibitory proteins in triple negative cancer cells by administering to a patient having cancer an effective amount of an antagonist of KLF4-dependent microRNAs.
    Type: Grant
    Filed: August 31, 2016
    Date of Patent: March 5, 2019
    Assignee: West Virginia University
    Inventors: Sriganesh B. Sharma, Chen-Chung Lin, Mark K. Farrugia, J. Michael Ruppert
  • MicroRNAs 206 and 21 Cooperate To Promote RAS-Extracellular Signal-Regulated Kinase Signaling by Suppressing the Translation of RASA1 and SPRED1
    Publication number: 20170067049
    Abstract: The present invention provides a method for inhibiting the RAS-ERK pathway by upregulation of RASA1 and SPRED1 mRNAs in tumor cells by anti-miR treatment. The method includes wherein an anti-miR-206 binds to a nucleotide comprising the sequence UAGCUUAUCAGACU (SEQ ID NO: 21), or to a nucleotide comprising the sequence UGGAAUGUAAGGAAGUGUGUGG (SEQ ID NO: 9). A method of re-expression of RAS-ERK pathway inhibitory proteins in triple negative cancer cells by administering to a patient having cancer an effective amount of an antagonist of KLF4-dependent microRNAs.
    Type: Application
    Filed: August 31, 2016
    Publication date: March 9, 2017
    Inventors: Sriganesh B. Sharma, Chen-Chung Lin, Mark K. Farrugia, J. Michael Ruppert
  • Trench shield directly ridable and movable on a constructing pipe
    Patent number: 6164875
    Abstract: A trench shield includes a pair of shielding panels for protecting opposite side walls of a trench excavation, two side frames are provided for restively adjustably securing the two shielding panels on the two side frames, and have a plurality of brace members spaced between the two side frames for retaining the two side frames and the two shielding panels, and two rolling devices respectively are mounted on a front bottom portion and a rear bottom portion of the trench shield for carrying the trench shield to be ridable and movable on a pipe under construction in the trench excavation. Upon rolling of the rolling devices on the constructing pipe, the trench shield will be conveniently moved on the pipe without any obstruction.
    Type: Grant
    Filed: April 14, 1999
    Date of Patent: December 26, 2000
    Assignee: Institute of Occupational Safety and Health, Council of Labor Affairs
    Inventors: Shih-Hsiung Wu, Chen-Chung Lin, Cheng-Yang Hsu
  • Trench shield having wheels simultaneously provided for protection and rolling purposes
    Patent number: 6155750
    Abstract: A trench shield includes: a pair of shielding wheels rotatably mounted on a pair of retaining plates; a plurality of brace members passing through two retaining plates for retaining the two shielding wheels, each shielding wheel formed as a protective circular panel for shielding a side wall of a trench excavation for preventing collapse of the trench walls; and two control devices each provided for locking or unlocking each shielding wheel on each retaining plate; whereby upon unlocking of the wheels from the retaining plates and upon rolling of the wheels in the trench, the trench shield will be forwardly moved conveniently and smoothly.
    Type: Grant
    Filed: April 14, 1999
    Date of Patent: December 5, 2000
    Assignee: Institute of Occupational Safety and Health, Council of Labor Affairs
    Inventors: Shih-Hsiung Wu, Chen-Chung Lin, Cheng-Yang Hsu