Patents by Inventor Christoph Cichon

Christoph Cichon has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • miRNA 320a as biomarker for inflammatory bowel disease
    Patent number: 10240203
    Abstract: The present invention relates to an in vitro method for diagnosing an acute or relapsing phase of inflammatory bowel disease as well as a method for treating the acute or relapsing phase of inflammatory bowel disease. In addition, the present invention relates to a medicament for use in the treatment of inflammatory bowel disease. Further comprised by the present invention is the use of a nucleic acid molecule of SEQ ID NO: 1 or 2 for monitoring the progression of said disease and in vitro diagnosis of an acute or relapsing phase of said disease. Also a device for the diagnosis of said disease and kits for performing the method of the present invention are envisaged by the present invention.
    Type: Grant
    Filed: July 16, 2015
    Date of Patent: March 26, 2019
    Assignee: Westfaelische Wilhelms-Universitaet Muenster
    Inventors: Alexander Schmidt, Christoph Cichon
  • miRNA 320a as Biomarker for Inflammatory Bowel Disease
    Publication number: 20170191130
    Abstract: The present invention relates to an in vitro method for diagnosing an acute or relapsing phase of inflammatory bowel disease as well as a method for treating the acute or relapsing phase of inflammatory bowel disease. In addition, the present invention relates to a medicament for use in the treatment of inflammatory bowel disease. Further comprised by the present invention is the use of a nucleic acid molecule of SEQ ID NO: 1 or 2 for monitoring the progression of said disease and in vitro diagnosis of an acute or relapsing phase of said disease. Also a device for the diagnosis of said disease and kits for performing the method of the present invention are envisaged by the present invention.
    Type: Application
    Filed: July 16, 2015
    Publication date: July 6, 2017
    Inventors: Alexander Schmidt, Christoph Cichon
  • NOVEL COMPOUNDS FOR THE TREATMENT OF INFLAMMATORY BOWEL DISEASE
    Publication number: 20140199402
    Abstract: The present invention relates to a nucleic acid molecule of up to 150 nucleotides comprising consecutively from 5? to 3? (a) a first part whose sequence is between 50% and 100% complementary to the sequence AAAAGCUGGGUUGAGAGGGCGA; (b) a second part capable of forming a loop between the first and the third part; and (c) a third part comprising or consisting of the sequence AAAAGCUGGGUUGAGAGGGCGA; for use as a medicament. The present invention further relates to a nucleic acid molecule of up to 25 nucleotides comprising the sequence AAAAGCUGGGUUGAGAGGGCGA, for use as a medicament. In another aspect, the present invention relates to a composition comprising at least one mature miRNA selected from the group consisting of hsa-miR-320a, ptr-miR-320a, ppy-miR-320a, bta-miR-320, cfa-miR-320, mmu-miR-320, rno-miR-320, and mml-miR-320, and/or one or more mir-RNA precursor(s) thereof, for use as a medicament.
    Type: Application
    Filed: August 9, 2012
    Publication date: July 17, 2014
    Inventors: Alexander Schmidt, Katharina Veltman, Christoph Cichon