Abstract: The present invention relates to systems and methods for predicting an individuals likely response to a pain medication comprising genotyping genetic variations in an individual to determine the individual's propensity for metabolizing a pain medication and likely response to a medication, and preferably diverse reactions to a medication. In particular, the invention comprises analyzing a biological sample provided by an individual, typically a patient or an individual diagnosed with a particular disorder, determining the individual's likely response to a particular treatment, more specifically a pain medication, and thereafter displaying, or further, recommending a plan of action or inaction. In particular, the present invention provides a grading method and system to profile an individual's response to one or more pain medication.

Abstract: Dual mode genetics testing systems are devised about a single element testing platform. A microfluidic network and system of interconnected receiving cells and reaction vessels supports at the same time genotyping and copy number analysis where the platform may be subject to a common thermal cycle schedule to cause the proper reactions (DNA replication) necessary in both test types. Further, the microfluidic platform which includes reaction vessels for genotyping which are spatially removed from reaction vessels for copy number analysis, is coupled to optical scanner and detection systems specifically arranged to apply test specific detection routines on each of these distinct regions or portions of the dual mode test platform.

Abstract: The present inventions relates to methods and assays to predict the response of an individual to psychiatric treatment and to a method to improve medical treatment of a disorder, which responsive to treatment with a psychiatric treatment.

Abstract: Silylated nitrones and methods of detecting and/or superoxide using silylated nitrones are disclosed herein.

Abstract: A notification system includes a specially-configured communications device, such as a smartphone, and a notification accessory that is linkable, e.g., via Bluetooth, to the communications device. The notification system allows a user to selectively, according to user preference, reproduce at the wearable accessory customized notifications corresponding to notifications that would otherwise occur at the communications device. The communications device includes software that allows a user to control whether and how notifications will be provided at the wearable accessory. Notifications may be made using vibratory and/or light signals, and the light signals may be provided in user-customizable colors and/or patterns. The notification accessory includes a functional module including circuitry enabling the notification accessory's functionality, and an outer housing enclosing the functional module. Various outer housings may be designed to be aesthetically appealing, e.g.

Abstract: The cotton variety FM 2322GL is disclosed. The invention relates to seeds, plants, plant cells, plant tissue, harvested products and cotton lint as well as to hybrid cotton plants and seeds obtained by repeatedly crossing plants of variety FM 2322GL with other plants. The invention also relates to plants and varieties produced by the method of essential derivation from plants of FM 2322GL and to plants of FM 2322GL reproduced by vegetative methods, including but not limited to tissue culture of regenerable cells or tissue from FM 2322GL.

Abstract: Biological sample collection kits are devised with physical features to enable a high performance collection system which delivers preprocessed biological matter via conventional shipping means to a testing laboratories. In particular, untrained and unskilled users deposit biological matter such as saliva or blood into a receiving vessel. By sealing the container, the user causes release of a premixed solution containing preservatives and optionally lysis reagents. In addition, a purification agent is arranged to bind to target molecules and facilitate their removal from solution. These time consuming processes occur while the sample is in transit to the testing facility such that when it arrives, it is in a preconditioned state immediately ready for execution of washing steps.

Abstract: Dual mode genetics testing systems are devised about a single element testing platform. A microfluidic network and system of interconnected receiving cells and reaction vessels supports at the same time genotyping and copy number analysis where the platform may be subject to a common thermal cycle schedule to cause the proper reactions (DNA replication) necessary in both test types. Further, the microfluidic platform which includes reaction vessels for genotyping which are spatially removed from reaction vessels for copy number analysis, is coupled to optical scanner and detection systems specifically arranged to apply test specific detection routines on each of these distinct regions or portions of the dual mode test platform.

Abstract: The present invention concerns an isolated polynucleotide comprising a nucleotide sequence having substantial homology to any of the following nucleotide sequences: catcgttatgggacta (SEQ ID NO: 2), cattcttgatccttcc (SEQ ID NO: 1), cttttcaatctgactg SEQ ID NO: atgaaaatactcataa (SEQ ID NO: 5), gtgataaaagaaccat (SEQ ID NO: 10), gggttcatgaaagtga (SEQ ID NO: 11), gatgaccctcttatcc (SEQ ID NO: 8), tggaaggaatgtctgg (SEQ ID NO: 4), gcatctgcttccaaca (SEQ ID NO: 3), catcgttaggctagctacaacgatgggacta (SEQ ID NO: 9), tccaccaaggctagctacaacgaccatcaaa (SEQ ID NO: 12), gtcaacaaggctagctacaacgatgagctca (SEQ ID NO: 13), and cttttcaaggctagctacaacgactgactgt (SEQ ID NO: 6), and their use in the treatment of wounds.

Abstract: The cotton variety FM 2011GT is disclosed. The invention relates to seeds, plants, plant cells, plant tissue, harvested products and cotton lint as well as to hybrid cotton plants and seeds obtained by repeatedly crossing plants of variety FM 2011GT with other plants. The invention also relates to plants and varieties produced by the method of essential derivation from plants of FM 2011GT and to plants of FM 2011GT reproduced by vegetative methods, including but not limited to tissue culture of regenerable cells or tissue from FM 2011GT.

Abstract: The cotton variety FM 9250GL is disclosed. The invention relates to seeds, plants, plant cells, plant tissue, harvested products and cotton lint as well as to hybrid cotton plants and seeds obtained by repeatedly crossing plants of variety FM 9250GL with other plants. The invention also relates to plants and varieties produced by the method of essential derivation from plants of FM 9250GL and to plants of FM 9250GL reproduced by vegetative methods, including but not limited to tissue culture of regenerable cells or tissue from FM 9250GL.

Abstract: The present invention relates in particular to a drive shaft assembly, e.g. as part of a rail adjustment system for a vehicle seat, with a flexible drive shaft for transferring an adjustment force, wherein the drive shaft has central part extending between the two shaft ends of the drive shaft, and the drive shaft is located with its central part at least partially in an elongate guide of the drive shaft assembly. At the central part of the drive shaft several sections arranged in the guide are provided with directly applied flock fibers, in a flocking process on a lateral surface of the drive shaft, which are spaced from each other along a shaft axis of the drive shaft and at which an outer diameter of the drive shaft is enlarged locally with regard to sections abutting these.

Abstract: An anti-cavitation seat which is disposable between an inlet and an outlet of a pressure reducing valve, and including a plurality of inlets causing fluid to flow into a converging pathway to reduce pressure of the fluid. The inlets form a tortuous path for a portion of the fluid flowing into the anti-cavitation seat, so as to further reduce the pressure of the fluid. A standard stem assembly is used in conjunction with the anti-cavitation seat to alter the flow of fluid through the valve.

Abstract: A control valve for hydraulic fluid is provided. The control valve includes a valve housing and a valve body slidably supported within the valve housing. The valve body has a hollow center defining a passage. The control valve includes a solenoid assembly having a solenoid housing, a coil, and an armature movable in an axial direction. The armature is in contact with an axial end of the valve body. The armature has a bore in fluid connection with the passage of the valve body. The solenoid housing includes a second passage in fluid connection with the bore. A diaphragm seals the second passage. A pressure sensor assembly is located adjacent to the diaphragm that detects a deflection of the diaphragm due to a pressure of the hydraulic fluid in the second passage.

Abstract: Saliva sample collection systems are configured with special attention to ease-of-use for the unskilled user and safe transport and delivery by a conventional delivery services such as Federal Express. A sealed cavity is formed by tight coupling of two primary elements: a receiving vessel element and a sealing cap element. The receiving vessel has integrated therewith: a standing means, a fill-line window, a funnel system, a knife, a threadset, and containment tube among others. A complementary cap element includes a cooperating threadset, label receiving surface, gripping surface, seal means and reservoir with piercable thin-film membrane. These two primary elements may be accommodated in an application-specific shipping container which support two shipping modes whereby the system may be shipped safely to and from a donor user each way in a different shipping mode.

Abstract: A control valve for hydraulic media is provided. The control valve includes a valve body having four ports. A first seat, a second seat, and a dual seat are positioned in the valve body between the ports. Two poppets, each including a disc and a cup, with a spring located therebetween, are arranged on a cylindrical pin with an enlarged engagement portion that is slidably supported within the valve body. A solenoid assembly movable in an axial direction within the valve body contacts the cylindrical pin and adjusts the position of the discs and cups of the poppets with respect to the seats of the valve body to minimize unwanted leakage between the ports. This configuration comprises four variable orifices that cooperate to provide controlled flow during different energizing phases of the solenoid assembly.

Abstract: A reactor including a monolith having a plurality of fins in an annular arrangement for receiving fluid flow through the reactor. The monolith is disposed within a generally cylindrical outer tube, and around a corrugated inner tube. The reactor includes a device for urging the monolith radially outward, so as to maintain contact between the monolith and the outer tube.

Abstract: Silylated nitrones and methods of detecting and/or superoxide using silylated nitrones are disclosed herein.

Abstract: The present inventions relates to methods and assays to predict the response of an individual to an analgesic treatment and to a method to improve medical treatment of a disorder, which is responsive to treatment with an analgesic.