Abstract: The disclosure provides, e.g., compositions, systems, and methods for targeting, editing, modifying, or manipulating a host cell's genome at one or more locations in a DNA sequence in a cell, tissue, or subject. Gene modifying systems for treating cystic fibrosis, e.g., in subjects having a mutation resulting in F508del, are described.

Abstract: The disclosure provides, e.g., compositions, systems, and methods for targeting, editing, modifying, or manipulating a host cell's genome at one or more locations in a DNA sequence in a cell, tissue, or subject. Gene modifying systems for treating alpha-1 antitrypsin deficiency (AATD) are described.

Abstract: The disclosure provides, e.g., compositions, systems, and methods for targeting, editing, modifying, or manipulating a host cell's genome at one or more locations in a DNA sequence in a cell, tissue, or subject. Gene modifying systems for treating phenylketonuria (PKU) are described.

Abstract: The invention relates to a sol-gel method for producing an anti-reflective coating from alcoxide-type precursors, that can subsequently be applied to glass or plastic substrates by spraying. The invention also relates to optical and thermoelectrical devices that have been coated with said anti-reflective material. This coating increases the transmittance of the transparent substrates over which it is applied, as a result of which it is useful to apply over high concentration solar modules (HCPV), for both primary lenses and secondary lenses, in conventional silicon or in CSP tubes.

Abstract: The present disclosure concerns the use of biologically active apelin peptides and compositions that are processed from larger precursor proteins and further post-translationally modified to influence cell growth. Particular methods are useful for promoting cell growth, while others are particularly useful for inhibiting cell growth.

Abstract: The present disclosure concerns the use of biologically active apelin peptides and compositions that are processed from larger precursor proteins and further post-translationally modified to influence cell growth. Particular methods are useful for promoting cell growth, while others are particularly useful for inhibiting cell growth.

Abstract: The invention provides a system for leak detection of a fluid in a pipe network. The system includes flow meters, and vibration detectors adapted to be attached to a pipe at a location in the pipe network. A processor analyzes signals generated by the flow meters and vibration detectors to identify the presence of one or more leaks in the pipe network. The invention also provides a method for detecting and localizing leaks in a pipeline network, and a device comprising a flow meter integral with a vibration detector for use in the system of the invention.

Abstract: The present disclosure concerns the use of biologically active apelin peptides and compositions that are processed from larger precursor proteins and further post-translationally modified to influence cell growth. Particular methods are useful for promoting cell growth, while others are particularly useful for inhibiting cell growth.

Abstract: In a method and system for securitizing contracts valued on an index, a special purpose entity (SPE) is provided and holds as substantially all of its assets a derivative contract with a contract dealer. The contract has an initial notional value and is tied to an index related to items traded by a multilateral transactional execution facility, such as futures contracts traded on an exchange. The held contract is also scalable so that the notional value can be increased on demand in exchange for a corresponding payment to the contract dealer and decreased on demand in exchange for a corresponding payment from the contract dealer. The SPE issues exchange tradable securities that derive value based on the value of the contract held by the SPE. To issue additional shares, assets are contributed to the contract dealer who increases the notional value of the contract held by the SPE. The increase in value of the contract supports the issuance of additional shares.

Abstract: The present invention provides for an electronic exchange that provides a marketplace for the trading and settling of currency futures contracts, having methods and systems that include features such as an enhanced execution facility, clearing facility and futures contracts to facilitate such market without the disadvantages of the existing foreign exchange market centers and currency futures contract markets.

Abstract: A method of detecting a neurodegenerative disease in a mammal, which method comprises assaying the copy number of a Cripto-1 gene or the expression level of a Cripto-1 gene product in the central nervous system of the mammal, wherein an amplification of the Cripto-1 gene or an overexpression of the Cripto-1 gene product is indicative of a neurodegenerative disease in the mammal; a method of inhibiting progression of a neurodegenerative disease in a mammal, which method comprises administering to the mammal an agent that inhibits Cripto-1 in an amount effective to inhibit Cripto-1 in the central nervous system of the mammal, whereupon the progression of the neurodegenerative disease is inhibited; and an isolated or purified oligonucleotide consisting essentially of the sequence of AAGCTATGGACTGCAGGAAGATGG (SEQ ID NO: 3) or AGAAGGCAGATGCCACTAGC (SEQ ID NO: 4).

Abstract: The present invention provides methods and compositions for the detection and quantification of Cripto-1. In particular, the present invention provides methods and compositions for the detection and quantification of Cripto-1 in samples such as milk, plasma, serum, and other biological fluids. In particularly preferred embodiments, the present invention finds use in the detection and/or quantification of Cripto-1 in human milk, plasma, serum, and other biological fluids.

Abstract: A polymeric hydrogel having a network of a macropores and micropores formed by copolymerizing at least one monomer having at least one double bond and at least one crosslinker having at least two double bonds in the presence of an organic additive forming a hydro-organic system with water, and uses thereof as separation media.

Abstract: In a method and system for securitizing contracts valued on an index, a special purpose entity (SPE) is provided and holds as substantially all of its assets a derivative contract with a contract dealer. The contract has an initial notional value and is tied to an index related to items traded by a multilateral transactional execution facility, such as futures contracts traded on an exchange. The held contract is also scalable so that the notional value can be increased on demand in exchange for a corresponding payment to the contract dealer and decreased on demand in exchange for a corresponding payment from the contract dealer. The SPE issues exchange tradable securities that derive value based on the value of the contract held by the SPE. To issue additional shares, assets are contributed to the contract dealer who increases the notional value of the contract held by the SPE. The increase in value of the contract supports the issuance of additional shares.

Abstract: Methods for creating and providing securities for investors and other market-interested parties involve creating investment entities with associated assets and corresponding securities, such as shares in the investment entities, in a time effective manner and in response to an investor's demand. The assets of the investment entity may be formed as an exchange traded fund (“ETF”) and may include shares of stock, bonds, options, convertibles, currencies, warrants, futures, commodities, real estate, other hard or soft assets and/or other items of value. An investment entity may be formed in any suitable legal structure, such as, but not limited to, a corporation, organization, business trusts, partnerships or the like, that is capable of holding the assets of the investment entity. An investment entity may hold one or more portfolios of common stocks, bonds, or other assets.