Patents by Inventor David Whitmore

David Whitmore has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Patent number: 12534812
    Abstract: An anode apparatus for mounting on an external surface of a concrete structure to provide cathodic protection of metal members in the concrete uses a pre-assembled body which is typically elongate carrying a longitudinal anode, which can be sacrificial or impressed current, together with a supporting material having a front face for attachment to the surface and an impermeable plastic covering material at the rear face covering the anode and the supporting material when the front face is attached to the surface of the concrete. A channel defined on the front face is arranged to receive a layer of a conformable ionically conductive adhesive material for attachment to the external surface. A distance of the edge of the covering material is arranged to be similar to a distance of the metal from the external surface such that wetting and drying effects of environmental moisture are the same for the anode as for the metal components.
    Type: Grant
    Filed: August 30, 2022
    Date of Patent: January 27, 2026
    Assignee: Vector Corrosion Technologies Ltd.
    Inventors: John Chris Ball, David Whitmore, Martin Beaudette, Gerald Bruce Hiebert, George Sergi, David Simpson
  • Patent number: 12428736
    Abstract: Cathodic protection of steel in a concrete column in sea water is simplified by providing a pre-assembled unit including a jacket to surround the column carrying a bulk sacrificial anode outside the jacket and optionally an inner sacrificial anode of a zinc mesh or strips on an inside surface. The jacket can also include a pre-assembled junction box and couplings to connect to the steel. The jacket is attached to the surface of the column at the water line so that the bulk anode is located below the surface of the water and supported relative to the concrete surface solely by the connection of the bulk anode to the covering layer. The bulk anode can be formed of aluminum so as to be less toxic in sea water.
    Type: Grant
    Filed: September 16, 2022
    Date of Patent: September 30, 2025
    Assignee: Vector Corrosion Technologies Ltd.
    Inventors: Matthew Miltenberger, Jason Chodachek, John Ball, David Whitmore
  • Publication number: 20240093461
    Abstract: Cathodic protection of steel in a concrete column in sea water is simplified by providing a pre-assembled unit including a jacket to surround the column carrying a bulk sacrificial anode outside the jacket and optionally an inner sacrificial anode with a cast grout inside the jacket. The jacket can also include a pre-assembled junction box and couplings to connect to the steel. The jacket is attached to the surface of the column at the water line so that the bulk anode is located below the surface of the water. The bulk anode can be formed of aluminum so as to be less toxic in sea water. An activator is applied inside the jacket either as a wicking layer or as a chemical activating material. The jacket can act only as a form work which is then removed after casting of the grout.
    Type: Application
    Filed: September 15, 2023
    Publication date: March 21, 2024
    Inventors: Matthew Miltenberger, Jason Chodachek, John Ball, David Whitmore
  • Publication number: 20240093381
    Abstract: Cathodic protection of steel in a concrete column in sea water is simplified by providing a pre-assembled unit including a jacket to surround the column carrying a bulk sacrificial anode outside the jacket and optionally an inner sacrificial anode of a zinc mesh or strips on an inside surface. The jacket can also include a pre-assembled junction box and couplings to connect to the steel. The jacket is attached to the surface of the column at the water line so that the bulk anode is located below the surface of the water and supported relative to the concrete surface solely by the connection of the bulk anode to the covering layer. The bulk anode can be formed of aluminum so as to be less toxic in sea water.
    Type: Application
    Filed: September 16, 2022
    Publication date: March 21, 2024
    Inventors: Matthew Miltenberger, Jason Chodachek, John Ball, David Whitmore
  • Publication number: 20240068110
    Abstract: An anode apparatus for mounting on an external surface of a concrete structure to provide cathodic protection of metal members in the concrete uses a pre-assembled body which is typically elongate carrying a longitudinal anode, which can be sacrificial or impressed current, together with a supporting material having a front face for attachment to the surface and an impermeable plastic covering material at the rear face covering the anode and the supporting material when the front face is attached to the surface of the concrete. A channel defined on the front face is arranged to receive a layer of a conformable ionically conductive adhesive material for attachment to the external surface. A distance of the edge of the covering material is arranged to be similar to a distance of the metal from the external surface such that wetting and drying effects of environmental moisture are the same for the anode as for the metal components.
    Type: Application
    Filed: August 30, 2022
    Publication date: February 29, 2024
    Inventors: John Chris Ball, David Whitmore, Martin Beaudette, Gerald Bruce Hiebert, George Sergi, David Simpson
  • Patent number: 10077554
    Abstract: Steel reinforcing cables in concrete are protected against corrosion by injecting a carrier fluid and corrosion inhibitors into interstitial spaces between the wires of the cable at a first location along the cable and causing the fluid to pass through the interstitial spaces between the wires of the cable to a second location along the cable. The cable comprises an array of wires confined together and intimately surrounded by a covering material which is engaged with a periphery of the cable so that there are insufficient interconnected spaces between the cable and the covering material to allow passage of fluid longitudinally along the cable outside the cable itself. The method can be used with pre-stressed concrete, with post-tensioned bonded cables and with extruded un-bonded mono-strand cables.
    Type: Grant
    Filed: July 15, 2016
    Date of Patent: September 18, 2018
    Inventor: David Whitmore
  • Patent number: 10053782
    Abstract: Corrosion protection of steel in concrete is provided by locating an anode assembly including both a sacrificial anode and an impressed current anode in contact with the concrete and providing an impressed current from a power supply to the anode. The impressed current anode forms a perforated sleeve surrounding a rod of the sacrificial anode material with an activated ionically-conductive filler material between. The system can be used without the power supply in sacrificial mode or when the power supply is connected, the impressed current anode can be powered to provide an impressed current system and/or to recharge the sacrificial anode from sacrificial anode corrosion products.
    Type: Grant
    Filed: January 21, 2015
    Date of Patent: August 21, 2018
    Assignee: Vector Corrosion Technologies Ltd.
    Inventors: George Sergi, Attanayake Mudiyanselage Gamini Seneviratne, David Whitmore
  • Patent number: 9909220
    Abstract: In a method of corrosion protection of rebar in concrete the sacrificial anode is held in place by wrapping a first wire around a first rebar portion and a second wire at second rebar portion and twisting together the first and second free ends to tension the wrappings. This can be used either on two separate rebars which are parallel or at right angles or can be used at longitudinally spaced positions on a single rebar where the rebar roughening prevents the two wrappings from sliding as the wires are tensioned by the twisting. In many cases a covering material such as a porous mortar is cast onto the outer surface of the anode and in this case the mortar and the wire are located such that the wire exits from the sacrificial anode at a position separate from the layer of covering material.
    Type: Grant
    Filed: December 1, 2014
    Date of Patent: March 6, 2018
    Assignee: Vector Corrosion Technologies Ltd.
    Inventor: David Whitmore
  • Publication number: 20170096817
    Abstract: Steel reinforcing cables in concrete are protected against corrosion by injecting a carrier fluid and corrosion inhibitors into interstitial spaces between the wires of the cable at a first location along the cable and causing the fluid to pass through the interstitial spaces between the wires of the cable to a second location along the cable. The cable comprises an array of wires confined together and intimately surrounded by a covering material which is engaged with a periphery of the cable so that there are insufficient interconnected spaces between the cable and the covering material to allow passage of fluid longitudinally along the cable outside the cable itself. The method can be used with pre-stressed concrete, with post-tensioned bonded cables and with extruded un-bonded mono-strand cables.
    Type: Application
    Filed: July 15, 2016
    Publication date: April 6, 2017
    Inventor: David Whitmore
  • Patent number: 9447506
    Abstract: Corrosion of steel in a concrete structure such as a column in sea water occurs primarily above the water line and is inhibited using cathodic protection by attaching to the column an impervious sealed sleeve in which is provided a sacrificial anode in sheet form in contact with a layer of water transport medium so that water from the location of the bottom of the water transport medium within the water is carried into the area of the sacrificial anode to enhance ionic current.
    Type: Grant
    Filed: July 30, 2012
    Date of Patent: September 20, 2016
    Inventor: David Whitmore
  • Publication number: 20160153096
    Abstract: In a method of corrosion protection of rebar in concrete the sacrificial anode is held in place by wrapping a first wire around a first rebar portion and a second wire at second rebar portion and twisting together the first and second free ends to tension the wrappings. This can be used either on two separate rebars which are parallel or at right angles or can be used at longitudinally spaced positions on a single rebar where the rebar roughening prevents the two wrappings from sliding as the wires are tensioned by the twisting. In many cases a covering material such as a porous mortar is cast onto the outer surface of the anode and in this case the mortar and the wire are located such that the wire exits from the sacrificial anode at a position separate from the layer of covering material.
    Type: Application
    Filed: December 1, 2014
    Publication date: June 2, 2016
    Inventor: David Whitmore
  • Publication number: 20150299868
    Abstract: Corrosion protection of steel in concrete is provided by locating an anode assembly including both a sacrificial anode and an impressed current anode in contact with the concrete and providing an impressed current from a power supply to the anode. The impressed current anode forms a perforated sleeve surrounding a rod of the sacrificial anode material with an activated ionically-conductive filler material between. The system can be used without the power supply in sacrificial mode or when the power supply is connected, the impressed current anode can be powered to provide an impressed current system and/or to recharge the sacrificial anode from sacrificial anode corrosion products.
    Type: Application
    Filed: January 21, 2015
    Publication date: October 22, 2015
    Inventors: George Sergi, Attanayake Mudiyanselage Gamini Seneviratne, David Whitmore
  • Publication number: 20150218562
    Abstract: The present invention concerns an isolated polynucleotide comprising a nucleotide sequence having substantial homology to any of the following nucleotide sequences: catcgttatgggacta (SEQ ID NO: 2), cattcttgatccttcc (SEQ ID NO: 1), cttttcaatctgactg SEQ ID NO: atgaaaatactcataa (SEQ ID NO: 5), gtgataaaagaaccat (SEQ ID NO: 10), gggttcatgaaagtga (SEQ ID NO: 11), gatgaccctcttatcc (SEQ ID NO: 8), tggaaggaatgtctgg (SEQ ID NO: 4), gcatctgcttccaaca (SEQ ID NO: 3), catcgttaggctagctacaacgatgggacta (SEQ ID NO: 9), tccaccaaggctagctacaacgaccatcaaa (SEQ ID NO: 12), gtcaacaaggctagctacaacgatgagctca (SEQ ID NO: 13), and cttttcaaggctagctacaacgactgactgt (SEQ ID NO: 6), and their use in the treatment of wounds.
    Type: Application
    Filed: April 23, 2013
    Publication date: August 6, 2015
    Applicant: CoDa Therapeutics, Inc.
    Inventors: Peter Cormie, David Becker, David Whitmore
  • Patent number: 8968549
    Abstract: Cathodic protection of steel in concrete is provided by locating an anode assembly including both a sacrificial anode and an impressed current anode in contact with the concrete and providing an impressed current from a power supply to the anode. The impressed current anode forms a perforated sleeve surrounding a rod of the sacrificial anode material with an activated ionically-conductive filler material between. The system can be used without the power supply in sacrificial mode or when the power supply is connected, the impressed current anode can be powered to provide an impressed current system and/or to recharge the sacrificial anode from sacrificial anode corrosion products.
    Type: Grant
    Filed: July 19, 2012
    Date of Patent: March 3, 2015
    Assignee: Vector Corrosion Technologies Ltd.
    Inventors: George Sergi, Attanayake Mudiyanselage Gamini Seneviratne, David Whitmore
  • Patent number: 8961746
    Abstract: Cathodic protection of steel in concrete is provided by locating an anode assembly including both a sacrificial anode and an impressed current anode in contact with the concrete and providing an impressed current from a power supply to the anode. The impressed current anode forms a perforated sleeve surrounding a rod of the sacrificial anode material with an activated ionically-conductive filler material between. The system can be used without the power supply in sacrificial mode or when the power supply is connected, the impressed current anode can be powered to provide an impressed current system and/or to recharge the sacrificial anode from sacrificial anode corrosion products.
    Type: Grant
    Filed: July 19, 2012
    Date of Patent: February 24, 2015
    Assignee: Vector Corrosion Technologies Ltd.
    Inventors: George Sergi, Attanayake Mudiyanselage Gamini Seneviratne, David Whitmore
  • Publication number: 20140048975
    Abstract: Steel reinforcing cables in concrete are protected against corrosion by injecting a carrier fluid and corrosion inhibitors into interstitial spaces between the wires of the cable at a first location along the cable and causing the fluid to pass through the interstitial spaces between the wires of the cable to a second location along the cable. The cable comprises an array of wires confined together and intimately surrounded by a covering material which is engaged with a periphery of the cable so that there are insufficient interconnected spaces between the cable and the covering material to allow passage of fluid longitudinally along the cable outside the cable itself. The method can be used with pre-stressed concrete, with post-tensioned bonded cables and with extruded un-bonded mono-strand cables.
    Type: Application
    Filed: August 14, 2012
    Publication date: February 20, 2014
    Inventor: David Whitmore
  • Publication number: 20140027306
    Abstract: Corrosion of steel in a concrete structure such as a column in sea water occurs primarily above the water line and is inhibited using cathodic protection by attaching to the column an impervious sealed sleeve in which is provided a sacrificial anode in sheet form in contact with a layer of water transport medium so that water from the location of the bottom of the water transport medium within the water is carried into the area of the sacrificial anode to enhance ionic current.
    Type: Application
    Filed: July 30, 2012
    Publication date: January 30, 2014
    Inventor: David Whitmore
  • Patent number: RE45234
    Abstract: Cathodic protection of steel in a building or other concrete or similar structure is provided by locating an anode in a suitable location adjacent to the steel and providing an impressed current from a power supply to the anode. The anode is formed from a material which is more electro-negative than the steel so that in the event that the power supply falls below the galvanic potential therebetween, current flows under galvanic action to replace the impressed current. A diode in the circuit prevents flow of current across the power supply but allows the galvanic current when the power supply fails open circuit. An additional diode can be provided in the event the power supply fails closed circuit to prevent reverse current flow.
    Type: Grant
    Filed: September 2, 2009
    Date of Patent: November 11, 2014
    Assignee: Vector Corrosion Technologies Ltd
    Inventors: David Whitmore, John Christopher Ball
  • Patent number: RE49882
    Abstract: Corrosion protection of steel in concrete is provided by locating an anode assembly including both a sacrificial anode and an impressed current anode in contact with the concrete and providing an impressed current from a power supply to the anode. The impressed current anode forms a perforated sleeve surrounding a rod of the sacrificial anode material with an activated ionically-conductive filler material between. The system can be used without the power supply in sacrificial mode or when the power supply is connected, the impressed current anode can be powered to provide an impressed current system and/or to recharge the sacrificial anode from sacrificial anode corrosion products.
    Type: Grant
    Filed: June 23, 2022
    Date of Patent: March 26, 2024
    Assignee: Vector Corrosion Technologies Ltd.
    Inventors: George Sergi, Attanayake Mudiyanselage Gamini Seneviratne, David Whitmore
  • Patent number: RE50006
    Abstract: Corrosion protection of steel in concrete is provided by locating an anode assembly including both a sacrificial anode and an impressed current anode in contact with the concrete and providing an impressed current from a power supply to the anode. The impressed current anode forms a perforated sleeve surrounding a rod of the sacrificial anode material with an activated ionically-conductive filler material between. The system can be used without the power supply in sacrificial mode or when the power supply is connected, the impressed current anode can be powered to provide an impressed current system and/or to recharge the sacrificial anode from sacrificial anode corrosion products.
    Type: Grant
    Filed: August 21, 2020
    Date of Patent: June 11, 2024
    Assignee: Vector Corrosion Technologies Ltd.
    Inventors: George Sergi, Attanayake Mudiyanselage Gamini Seneviratne, David Whitmore