Abstract: The present invention relates to a piRNA-54265 detection kit used for early screening, diagnosis, efficacy monitoring and/or prognostic evaluation of colorectal cancer. The detection kit includes a primers combination, including a primer pair and a probe for specifically detecting piRNA-54265; the primer pair is a piRNA-54265 stem-loop PCR primer pair, or a piRNA-54265 PolyA tailed PCR primer pair; the primer pair includes a forward primer and a reverse primer.

Abstract: The present invention relates to a piRNA-54265 detection kit used for early screening, diagnosis, efficacy monitoring and/or prognostic evaluation of colorectal cancer. The detection kit includes a primers combination, including a primer pair and a probe for specifically detecting piRNA-54265; the primer pair is a piRNA-54265 stem-loop PCR primer pair, or a piRNA-54265 PolyA tailed PCR primer pair; the primer pair includes a forward primer and a reverse primer.

Abstract: The present invention relates to a marker piRNA-54265 and a method in diagnosis, treatment, and prognostic evaluation of colorectal cancer. The marker piRNA-54265 is capable of being used for diagnosing and/or treating colorectal cancer, wherein the marker piRNA-54265 is selected from any of molecules as follows: (1) SEQ ID NO.29: tggaggtgatgaactgtctgagcctgacc; (2) SEQ ID NO.30: UGGAGGUGAUGAACUGUCUGAGCCUGACC; (3) SEQ ID NO.31: GGUCAGGCUCAGACAGUUCAUCACCUCCA; (4) a piR-54265 variant and a piR-54265 derivative modified from the molecule shown in (1), (2) or (3) with a same function; (5) a piR-54265 polynucleotide construct capable of down-regulating an amount of the piR-54265 in vivo after being introduced; and (6) an expression vector containing the polynucleotide construct of (5). The method is used for diagnosing/screening colorectal cancer, evaluating chemosensitivity of a colorectal cancer patient, evaluating a prognosis of a colorectal cancer patient or treating colorectal cancer.