Abstract: A laser diode assembly has a laser diode. The laser diode has an emitting surface and a reflective surface opposing the emitting surface. The laser diode has first and second side surfaces between the emitting and reflective surfaces. A first electrically-insulating heat sink is attached to the first side surface of the laser diode via a first solder bond, and the first heat sink has a first cooling channel. A second electrically-insulating heat sink is attached to the second side surface of the laser diode via a second solder bond, and the second electrically-insulating heat sink has a second cooling channel. A substrate has a top side and a bottom side, and the top side being in communication with a first bottom side of the first electrically-insulating heat sink and a second bottom side of the second electrically-insulating heat sink. The substrate has a flow channel system for passing a coolant to the first cooling channel and the second cooling channel.

Abstract: A laser diode package (10) according to the present invention is tolerant of short-circuit and open-circuit failures. The laser diode package (10) includes a laser diode bar (12), a forward-biased diode (14), a heat sink (18), and a lid (16) which may have fusible links (86). The laser diode bar (12) and the forward-biased diode (14) are electrically connected in parallel between the heat sink (18) and the lid (16). The emitting region of the laser diode bar (12) is aligned to emit radiation away from the forward-biased diode (14). Several packages can be stacked together to form a laser diode array (42). The forward-biased diode (14) allows current to pass through it when an open-circuit failure has occurred in the corresponding laser diode bar (12), thus preventing an open-circuit failure from completely disabling the array (42).

Abstract: A method of detecting a neurodegenerative disease in a mammal, which method comprises assaying the copy number of a Cripto-1 gene or the expression level of a Cripto-1 gene product in the central nervous system of the mammal, wherein an amplification of the Cripto-1 gene or an overexpression of the Cripto-1 gene product is indicative of a neurodegenerative disease in the mammal; a method of inhibiting progression of a neurodegenerative disease in a mammal, which method comprises administering to the mammal an agent that inhibits Cripto-1 in an amount effective to inhibit Cripto-1 in the central nervous system of the mammal, whereupon the progression of the neurodegenerative disease is inhibited; and an isolated or purified oligonucleotide consisting essentially of the sequence of AAGCTATGGACTGCAGGAAGATGG (SEQ ID NO: 3) or AGAAGGCAGATGCCACTAGC (SEQ ID NO: 4).

Abstract: A laser diode assembly has a laser diode. The laser diode has an emitting surface and a reflective surface opposing the emitting surface. The laser diode has first and second side surfaces between the emitting and reflective surfaces. A first electrically-insulating heat sink is attached to the first side surface of the laser diode via a first solder bond, and the first heat sink has a first cooling channel. A second electrically-insulating heat sink is attached to the second side surface of the laser diode via a second solder bond, and the second electrically-insulating heat sink has a second cooling channel. A substrate has a top side and a bottom side, and the top side being in communication with a first bottom side of the first electrically-insulating heat sink and a second bottom side of the second electrically-insulating heat sink. The substrate has a flow channel system for passing a coolant to the first cooling channel and the second cooling channel.

Abstract: A laser diode package includes a heat sink, a laser diode, and an electrically nonconductive (i.e. insulative) substrate. The laser diode has an emitting surface and a reflective surface opposing the emitting surface. The laser diode further has first and second side surfaces between the emitting and reflective surfaces. The heat sink has an upper surface and a lower surface. The first side surface of the laser diode is attached to the heat sink adjacent to the upper surface. The substrate is attached to the lower surface of the heat sink. The heat sink is made of heat conducting metal such as copper and the substrate is preferably made from gallium arsenide. The substrate is soldered to the heat sink as is the laser diode bar. Due to the presence of the substrate at the lower end of the heat sink, each individual laser diode package has its own electrical isolation. Several packages can be easily attached together to form a laser diode array.