Patents by Inventor Elena MARROCCO

Elena MARROCCO has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Patent number: 11096955
    Abstract: The present invention relates to the treatment and/or prevention of a retinal disease by using a polynucleotide promoter wherein the polynucleotide or a variant thereof consists of the sequence (hRHOs-wt;?SEQ?ID?NO.?1) TCCTCCTAGTGTCACCTTGGCCCCTCTTAGAAGCCAATTAGGCCCTCAG TTTCTGCAGCGGGGATTAATATGATTATGAACACCCCCAATCTCCCAGA TGCTGATTCAGCCAGGAGCTTAGGAGGGGGAGGTCACTTTATAAGGGTC TGGGGGGGTCAGAACCCAGAGTCATCCAGCTGGAGCCCTGAGTGGCTGA GCTCAGGCCTTCGCAGCATTCTTGGGTGGGAGCAGCCACGGGTCAGCCA CAAGGGCCACAGCC? wherein the fragment TGAACACCCCCAATCTCCCAGATGCT which is the sequence from nucleotide 77 to nucleotide 102 of SEQ ID NO. 1, is substituted. The invention is also directed to the use of relative vector, vector systems, host cells and pharmaceutical compositions.
    Type: Grant
    Filed: February 9, 2017
    Date of Patent: August 24, 2021
    Assignee: Fondazione Telethon
    Inventors: Enrico Maria Surace, Mariangela Lupo, Salvatore Botta, Elena Marrocco, Nicola De Prisco
  • Patent number: 11098094
    Abstract: The present invention relates to proteins consisting of an artificial DNA-binding domain (DBD) and related molecules and uses thereof. In particular, the proteins are ZF-DBD or TALE-DBD and are used for the treatment of eye disorders caused by gain of function mutation. The disorder may be ADRP, in particular ADRP caused by mutation in the rhodopsin gene. The present invention also relates to a method to identify cis-regulatory elements and to modulate them via DBDs.
    Type: Grant
    Filed: November 20, 2014
    Date of Patent: August 24, 2021
    Assignee: FONDAZIONE TELETHON
    Inventors: Salvatore Botta, Enrico Maria Surace, Elena Marrocco
  • Patent number: 10369231
    Abstract: The present invention relates to at least one agent capable of increasing the level of one or more miRNA in a cell or cells of a subject, said miRNA comprising the sequence UUCCCUU, for use in the treatment and/or prevention of a retinal dystrophy, in particular characterized by photoreceptor degeneration, relative pharmaceutical compositions, nucleic acids, vectors and host cells.
    Type: Grant
    Filed: March 11, 2014
    Date of Patent: August 6, 2019
    Assignee: FONDAZIONE TELETHON
    Inventors: Sandro Banfi, Enrico Maria Surace, Ivan Conte, Marianthi Karali, Elena Marrocco
  • Publication number: 20190038660
    Abstract: The present invention relates to the treatment and/or prevention of a retinal disease by using a polynucleotide promoter wherein the polynucleotide or a variant thereof consists of the sequence (hRHOs-wt;?SEQ?ID?NO.?1) TCCTCCTAGTGTCACCTTGGCCCCTCTTAGAAGCCAATTAGGCCCTCAG TTTCTGCAGCGGGGATTAATATGATTATGAACACCCCCAATCTCCCAGA TGCTGATTCAGCCAGGAGCTTAGGAGGGGGAGGTCACTTTATAAGGGTC TGGGGGGGTCAGAACCCAGAGTCATCCAGCTGGAGCCCTGAGTGGCTGA GCTCAGGCCTTCGCAGCATTCTTGGGTGGGAGCAGCCACGGGTCAGCCA CAAGGGCCACAGCC wherein the fragment TGAACACCCCCAATCTCCCAGATGCT which is the sequence from nucleotide 77 to nucleotide 102 of SEQ ID NO. 1, is substituted. The invention is also directed to the use of relative vector, vector systems, host cells and pharmaceutical compositions.
    Type: Application
    Filed: February 9, 2017
    Publication date: February 7, 2019
    Inventors: Enrico Maria SURACE, Mariangela LUPO, Salvatore BOTTA, Elena MARROCCO, Nicola DE PRISCO
  • Publication number: 20160289284
    Abstract: The present invention relates to proteins consisting of an artificial DNA-binding domain (DBD) and related molecules and uses thereof. In particular, the proteins are ZF-DBD or TALE-DBD and are used for the treatment of eye disorders caused by gain of function mutation. The disorder may be ADRP, in particular ADRP caused by mutation in the rhodopsin gene. The present invention also relates to a method to identify cis-regulatory elements and to modulate them via DBDs.
    Type: Application
    Filed: November 20, 2014
    Publication date: October 6, 2016
    Inventors: Salvatore BOTTA, Enrico Maria SURACE, Elena MARROCCO
  • Publication number: 20160022836
    Abstract: The present invention relates to at least one agent capable of increasing the level of one or more miRNA in a cell or cells of a subject, said miRNA comprising the sequence UUCCCUU, for use in the treatment and/or prevention of a retinal dystrophy, in particular characterized by photoreceptor degeneration, relative pharmaceutical compositions, nucleic acids, vectors and host cells.
    Type: Application
    Filed: March 11, 2014
    Publication date: January 28, 2016
    Inventors: Sandro BANFI, Enrico Maria SURACE, Ivan CONTE, Marianthi KARALI, Elena MARROCCO