Abstract: The present invention relates to proteins consisting of an artificial DNA-binding domain (DBD) and related molecules and uses thereof. In particular, the proteins are ZF-DBD or TALE-DBD and are used for the treatment of eye disorders caused by gain of function mutation. The disorder may be ADRP, in particular ADRP caused by mutation in the rhodopsin gene. The present invention also relates to a method to identify cis-regulatory elements and to modulate them via DBDs.

Abstract: The present invention relates to the treatment and/or prevention of a retinal disease by using a polynucleotide promoter wherein the polynucleotide or a variant thereof consists of the sequence (hRHOs-wt;?SEQ?ID?NO.?1) TCCTCCTAGTGTCACCTTGGCCCCTCTTAGAAGCCAATTAGGCCCTCAG TTTCTGCAGCGGGGATTAATATGATTATGAACACCCCCAATCTCCCAGA TGCTGATTCAGCCAGGAGCTTAGGAGGGGGAGGTCACTTTATAAGGGTC TGGGGGGGTCAGAACCCAGAGTCATCCAGCTGGAGCCCTGAGTGGCTGA GCTCAGGCCTTCGCAGCATTCTTGGGTGGGAGCAGCCACGGGTCAGCCA CAAGGGCCACAGCC? wherein the fragment TGAACACCCCCAATCTCCCAGATGCT which is the sequence from nucleotide 77 to nucleotide 102 of SEQ ID NO. 1, is substituted. The invention is also directed to the use of relative vector, vector systems, host cells and pharmaceutical compositions.

Abstract: The present invention relates to at least one agent capable of increasing the level of one or more miRNA in a cell or cells of a subject, said miRNA comprising the sequence UUCCCUU, for use in the treatment and/or prevention of a retinal dystrophy, in particular characterized by photoreceptor degeneration, relative pharmaceutical compositions, nucleic acids, vectors and host cells.

Abstract: The present invention relates to the treatment and/or prevention of a retinal disease by using a polynucleotide promoter wherein the polynucleotide or a variant thereof consists of the sequence (hRHOs-wt;?SEQ?ID?NO.?1) TCCTCCTAGTGTCACCTTGGCCCCTCTTAGAAGCCAATTAGGCCCTCAG TTTCTGCAGCGGGGATTAATATGATTATGAACACCCCCAATCTCCCAGA TGCTGATTCAGCCAGGAGCTTAGGAGGGGGAGGTCACTTTATAAGGGTC TGGGGGGGTCAGAACCCAGAGTCATCCAGCTGGAGCCCTGAGTGGCTGA GCTCAGGCCTTCGCAGCATTCTTGGGTGGGAGCAGCCACGGGTCAGCCA CAAGGGCCACAGCC wherein the fragment TGAACACCCCCAATCTCCCAGATGCT which is the sequence from nucleotide 77 to nucleotide 102 of SEQ ID NO. 1, is substituted. The invention is also directed to the use of relative vector, vector systems, host cells and pharmaceutical compositions.

Abstract: The present invention relates to proteins consisting of an artificial DNA-binding domain (DBD) and related molecules and uses thereof. In particular, the proteins are ZF-DBD or TALE-DBD and are used for the treatment of eye disorders caused by gain of function mutation. The disorder may be ADRP, in particular ADRP caused by mutation in the rhodopsin gene. The present invention also relates to a method to identify cis-regulatory elements and to modulate them via DBDs.

Abstract: The present invention relates to at least one agent capable of increasing the level of one or more miRNA in a cell or cells of a subject, said miRNA comprising the sequence UUCCCUU, for use in the treatment and/or prevention of a retinal dystrophy, in particular characterized by photoreceptor degeneration, relative pharmaceutical compositions, nucleic acids, vectors and host cells.

Abstract: RNA interference using small interfering RNAs which target HIF-1 alpha mRNA inhibit expression of the HIF-1 alpha gene. As HIF-1 alpha is a transcriptional regulator of VEGF, expression of VEGF is also inhibited. Control of VEGF production through siRNA-mediated down-regulation of HIF-1 alpha can be used to inhibit angiogenesis, in particularly in diseases such as diabetic retinopathy, age related macular degeneration and many types of cancer.

Abstract: RNA interference using small interfering RNAs which target HIF-1 alpha mRNA inhibit expression of the HIF-1 alpha gene. As HIF-1 alpha is a transcriptional regulator of VEGF, expression of VEGF is also inhibited. Control of VEGF production through siRNA-mediated down-regulation of HIF-1 alpha can be used to inhibit angiogenesis, in particularly in diseases such as diabetic retinopathy, age related macular degeneration and many types of cancer.

Abstract: There are disclosed methods and compositions for recovering or improving visual function in a mammal, by means of adeno-associated viral vectors suitable for gene delivery to mammalian retina.

Abstract: RNA interference using small interfering RNAs which target HIF-1 alpha mRNA inhibit expression of the HIF-1 alpha gene. As HIF-1 alpha is a transcriptional regulator of VEGF, expression of VEGF is also inhibited. Control of VEGF production through siRNA-mediated down-regulation of HIF-1 alpha can be used to inhibit angiogenesis, in particularly in diseases such as diabetic retinopathy, age related macular degeneration and many types of cancer.

Abstract: RNA interference using small interfering RNAs which target HIF-1 alpha mRNA inhibit expression of the HIF-1 alpha gene. As HIF-1 alpha is a transcriptional regulator of VEGF, expression of VEGF is also inhibited. Control of VEGF production through siRNA-mediated down-regulation of HIF-1 alpha can be used to inhibit angiogenesis, in particularly in diseases such as diabetic retinopathy, age related macular degeneration and many types of cancer.

Abstract: The use of compounds that interfere with the hedgehog signaling pathway for the manufacture of a medicament for preventing, inhibiting, and/or reversing ocular diseases related with ocular neovascularization. Particularly, the above-mentioned diseases are (wet) age-related macular degeneration, (proliferative) diabetic retinopathy, neovascular glaucoma, retinal vein occlusion, or retinopathy of prematurity (ROP).

Abstract: RNA interference using small interfering RNAs which target HIF-1 alpha mRNA inhibit expression of the HIF-1 alpha gene. As HIF-1 alpha is a transcriptional regulator of VEGF, expression of VEGF is also inhibited. Control of VEGF production through siRNA-mediated down-regulation of HIF-1 alpha can be used to inhibit angiogenesis, in particularly in diseases such as diabetic retinopathy, age related macular degeneration and many types of cancer.

Abstract: RNA interference using small interfering RNAs which target HIF-1 alpha mRNA inhibit expression of the HIF-1 alpha gene. As HIF-1 alpha is a transcriptional regulator of VEGF, expression of VEGF is also inhibited. Control of VEGF production through siRNA-mediated down-regulation of HIF-1 alpha can be used to inhibit angiogenesis, in particularly in diseases such as diabetic retinopathy, age related macular degeneration and many types of cancer.

Abstract: The present invention concerns the use of compounds that interfere with the hedgehog signaling pathway for the manufacture of a medicament for preventing, inhibiting, and/or reversing ocular diseases related with ocular neovascularization. Particularly, the above-mentioned diseases are (wet) age-related macular degeneration, (proliferative) diabetic retinopathy, neovascular glaucoma, retinal vein occlusion, or retinopathy of prematurity (ROP).

Abstract: RNA interference using small interfering RNAs which target HIF-1 alpha mRNA inhibit expression of the HIF-1 alpha gene. As HIF-1 alpha is a transcriptional regulator of VEGF, expression of VEGF is also inhibited. Control of VEGF production through siRNA-mediated down-regulation of HIF-1 alpha can be used to inhibit angiogenesis, in particularly in diseases such as diabetic retinopathy, age related macular degeneration and many types of cancer.