Abstract: Herein is reported a method for producing a bispecific antibody comprising the step of incubating (i) an antibody Fab fragment or a scFv antibody comprising within the 20 C-terminal amino acid residues the amino acid sequence LPX1TG (SEQ ID NO: 01), (ii) a one-armed antibody comprising a full length antibody heavy chain, a full length antibody light chain, and an Fc-heavy chain, whereby the full length antibody heavy chain and the full length antibody light chain are cognate antibody chains that thereof forms an antigen binding site, whereby the full length antibody heavy chain and the Fc-heavy chain are covalently linked to each other via one or more disulfide bonds forming an antibody hinge region, and whereby the Fc-heavy chain has an oligoglycine amino acid sequence at its N-terminus, and (iii) a Sortase A enzyme.

Abstract: The combination of a first binding site specifically binding to a target associated with an eye disease and a second binding site specifically binding to a target influencing the retention in the eye a multispecific binder provides for improved intravitreal retention compared to a monospecific binder. The second binding site specifically binds to a compound/molecules found in the extracellular matrix (ECM) in vitreous humor/retina. This compound of the extracellular matrix has to be present in amounts allowing a sufficient loading/dose of the drug to be bound. It has been found that collagen, especially collagen II, is a suitable compound in the ECM in the vitreous humor for this purpose. Thus, herein is reported a multispecific binder comprising a first binding site specifically binding to a therapeutic ocular target, and a second binding site specifically binding to collagen II.

Abstract: Herein is reported a nucleic acid comprising in 5? to 3? direction i) a first nucleic acid fragment encoding a polypeptide of interest without an in frame translational stop codon, ii) a second nucleic acid fragment operably linked to said first nucleic acid fragment which is beginning with the 5? splice donor site of an immunoglobulin heavy chain CH3 or CH4 domain and which is terminated by the 3? splice acceptor site of the succeeding immunoglobulin heavy chain transmembrane domain exon M1 and which comprises in frame translational stop codon and a polyadenylation signal, and iii) a third nucleic acid fragment operably linked to said second nucleic acid encoding at least a fragment of a transmembrane domain, wherein the second nucleic acid fragment has at its 3? terminus the nucleotide sequence CTACCACCCCCTTCCTGTCCAG (SEQ ID NO: 29) or TGACCACGCCAATCGTGTCCAG (SEQ ID NO: 14) or CTACCACGCCAATCGTGTCCAG (SEQ ID NO: 31).

Abstract: Herein is reported a method for producing an antibody Fc-region conjugate comprising as first component an antibody Fc-region and as second component at least one binding entity that specifically binds to a target using a transpeptidase for enzymatic conjugation of the antibody Fc-region to at least one binding entity.

Abstract: Herein is reported a method for producing a bispecific antibody comprising the step of incubating (i) an antibody Fab fragment or a scFv antibody comprising within the 20 C-terminal amino acid residues the amino acid sequence LPX1TG (SEQ ID NO: 01), (ii) a one-armed antibody comprising a full length antibody heavy chain, a full length antibody light chain, and an Fc-heavy chain, whereby the full length antibody heavy chain and the full length antibody light chain are cognate antibody chains that thereof forms an antigen binding site, whereby the full length antibody heavy chain and the Fc-heavy chain are covalently linked to each other via one or more disulfide bonds forming an antibody hinge region, and whereby the Fc-heavy chain has an oligoglycine amino acid sequence at its N-terminus, and (iii) a Sortase A enzyme.

Abstract: Herein is reported a method for the detection of a sortase in a sample, comprising the following steps: a) incubating the sample with a first substrate comprising an immobilization tag and a second substrate comprising a detectable label, whereby in the presence of a sortase in the sample a conjugate comprising the immobilization tag and the detectable label is formed, b) immobilizing the conjugate of step a) via/using the immobilization tag to a solid phase, c) detecting the immobilized conjugate via/using the detectable label and thereby detecting the sortase in the sample.

Abstract: Herein is reported a method for producing an enzymatic conjugation product of three polypeptides comprising the simultaneous incubation of i) a first polypeptide comprising the amino acid sequence LPXTG (SEQ ID NO: 20, wherein X can be any amino acid residue), a second polypeptide comprising the amino acid sequence LPXTA (SEQ ID NO: 31, wherein X can be any amino acid residue), a third polypeptide that has two N-termini whereby the polypeptide has an oligo-glycine Gm (m=2 (SEQ ID NO: 22), or 3 (SEQ ID NO: 23), or 4 (SEQ ID NO: 24), or 5 (SEQ ID NO: 25)) amino acid sequence at its first N-terminus and an oligo-alanine Am (m=2 (SEQ ID NO: 26), or 3 (SEQ ID NO: 27), or 4 (SEQ ID NO: 28), or 5 (SEQ ID NO: 29)) amino acid sequence at its second N-terminus, a fourth polypeptide with sortase activity whereby the polypeptide is derived from Staphylococcus aureus sortase A, and a fifth polypeptide with sortase activity whereby the polypeptide is derived from Streptococcus pyogenes sortase A and the recovering of the c

Abstract: Herein is reported a method for producing a fusion-polypeptide comprising the seeps of a) cultivating a mammalian cell comprising a nucleic acid encoding a variant fusion-polypeptide wherein the amino acid sequence of the fusion-polypeptide has been modified by replacing in a pro-fusion-polypeptide the endogenous protease cleavage site between the pro-peptide and the fusion-polypeptide with an exogenous (with respect to the origins of the parts of the fusion-polypeptide) or artificial protease cleavage site, and b) recovering the fusion-polypeptide or fusion-pro-polypeptide from the cell or the cultivation median and thereby producing the (recombinant) fusion-polypeptide.

Abstract: The combination of a first binding site specifically binding to a target associated with an eye disease and a second binding site specifically binding to a target influencing the retention in the eye a multispecific binder provides for improved intravitreal retention compared to a monospecific binder. The second binding site specifically binds to a compound/molecules found in the extracellular matrix (ECM) in vitreous humor/retina. This compound of the extracellular matrix has to be present in amounts allowing a sufficient loading/dose of the drug to be bound. It has been found that collagen, especially collagen II, is a suitable compound in the ECM in the vitreous humor for this purpose. Thus, herein is reported a multispecific binder comprising a first binding site specifically binding to a therapeutic ocular target, and a second binding site specifically binding to collagen II.

Abstract: The combination of a first binding site specifically binding to a target associated with an eye disease and a second binding site specifically binding to a target influencing the retention in the eye a multispecific binder provides for improved intravitreal retention compared to a monospecific binder. The second binding site specifically binds to a compound/molecules found in the extracellular matrix (ECM) in vitreous humor/retina. This compound of the extracellular matrix has to be present in amounts allowing a sufficient loading/dose of the drug to be bound. It has been found that collagen, especially collagen II, is a suitable compound in the ECM in the vitreous humor for this purpose. Thus, herein is reported a multispecific binder comprising a first binding site specifically binding to a therapeutic ocular target, and a second binding site specifically binding to collagen II.

Abstract: Herein is reported a nucleic acid comprising in 5? to 3? direction i) a first nucleic acid fragment encoding a polypeptide of interest without an in frame translational stop codon, ii) a second nucleic acid fragment operably linked to said first nucleic acid fragment which is beginning with the 5? splice donor site of an immunoglobulin heavy chain CH3 or CH4 domain and which is terminated by the 3? splice acceptor site of the succeeding immunoglobulin heavy chain transmembrane domain exon M1 and which comprises in frame translational stop codon and a polyadenylation signal, and iii) a third nucleic acid fragment operably linked to said second nucleic acid encoding at least a fragment of a transmembrane domain, wherein the second nucleic acid fragment has at its 3? terminus the nucleotide sequence CTACCACCCCCTTCCTGTCCAG (SEQ ID NO: 29) or TGACCACGCCAATCGTGTCCAG (SEQ ID NO: 14) or CTACCACGCCAATCGTGTCCAG (SEQ ID NO: 31).

Abstract: In the method as reported herein the isolation of nucleic acid segments encoding antibody variable domains and the insertion of the isolated nucleic acid segments in eukaryotic expression plasmids is performed without the intermediate isolation and analysis of clonal intermediate plasmids. Thus, in the method as reported herein the intermediate cloning, isolation and analysis of intermediate plasmids is not required, e.g. by analysis of isolated transformed E. coli cells.

Abstract: Herein is reported a method for producing a fusion-polypeptide comprising the seeps of a) cultivating a mammalian cell comprising a nucleic acid encoding a variant fusion-polypeptide wherein the amino acid sequence of the fusion-polypeptide has been modified by replacing in a pro-fusion-polypeptide the endogenous protease cleavage site between the pro-peptide and the fusion-polypeptide with an exogenous (with respect to the origins of the parts of the fusion-polypeptide) or artificial protease cleavage site, and b) recovering the fusion-polypeptide or fusion-pro-polypeptide from the cell or the cultivation median and thereby producing the (recombinant) fusion-polypeptide.

Abstract: Herein is reported a method for producing a fusion-polypeptide comprising the steps of a) cultivating a mammalian cell comprising a nucleic acid encoding a variant fusion-polypeptide wherein the amino acid sequence of the fusion-polypeptide has been modified by replacing in a pro-fusion-polypeptide the endogenous protease cleavage site between the pro-peptide and the fusion-polypeptide with an exogenous (with respect to the origins of the parts of the fusion-polypeptide) or artificial protease cleavage site, and b) recovering the fusion-polypeptide or fusion-pro-polypeptide from the cell or the cultivation medium and thereby producing the (recombinant) fusion-polypeptide.

Abstract: The current invention reports a method for the recombinant production of a secreted heterologous immunoglobulin in a CHO cell comprising the following steps: i) providing a CHO cell, which is adapted to growth in suspension culture, adapted to growth in serum-free medium, mycoplasma free, and virus free, ii) providing a vector comprising a prokaryotic origin of replication, a first nucleic add conferring resistance to a prokaryotic selection agent, a second nucleic acid encoding the heavy chain of said heterologous immunoglobulin, a third nucleic acid encoding the light chain of said heterologous immunoglobulin, a fourth nucleic acid conferring resistance to a eukaryotic selection agent, iii) transfecting said CHO cell, wherein said transfecting comprises a) transfecting said CHO cell with said vector comprising a fourth nucleic acid conferring resistance to a first eukaryotic selection agent, h) selecting a CHO cell by growth in cultivation medium containing said first eukaryotic selection agent, c) transfec

Abstract: The combination of a first binding site specifically binding to a target associated with an eye disease and a second binding site specifically binding to a target influencing the retention in the eye a multispecific binder provides for improved intravitreal retention compared to a monospecific binder. The second binding site specifically binds to a compound/molecules found in the extracellular matrix (ECM) in vitreous humor/retina. This compound of the extracellular matrix has to be present in amounts allowing a sufficient loading/dose of the drug to be bound. It has been found that collagen, especially collagen II, is a suitable compound in the ECM in the vitreous humor for this purpose. Thus, herein is reported a multispecific binder comprising a first binding site specifically binding to a therapeutic ocular target, and a second binding site specifically binding to collagen II.

Abstract: Herein are reported glycosylated repeat-motif-molecule conjugate of the following formula: (repeat-motif-molecule?linkern)m?conjugation partner?(linkero?repeat-motif-molecule)p, wherein n and o are independently of each other and independently for each value of m and p integer values of 0 or 1, and m and p are independently of each other integer values of 0 or 1 or 2 or 3 or 4 or 5 or 6 or 7, and wherein the repeat-motif-molecule conjugate comprises at least one oligosaccharide attached to a glycosylation site. Also reported are encoding nucleic acids and method for producing these repeat-motif-conjugates in mammalian cells.

Abstract: Herein are reported glycosylated repeat-motif-molecule conjugate of the following formula: (repeat-motif-molecule?linkern)m?conjugation partner?(linkero?repeat-motif-molecule)p, wherein n and o are independently of each other and independently for each value of m and p integer values of 0 or 1, and m and p are independently of each other integer values of 0 or 1 or 2 or 3 or 4 or 5 or 6 or 7, and wherein the repeat-motif-molecule conjugate comprises at least one oligosaccharide attached to a glycosylation site. Also reported are encoding nucleic acids and method for producing these repeat-motif-conjugates in mammalian cells.

Abstract: Herein is reported a method for producing a bispecific antibody comprising the step of incubating (i) an antibody Fab fragment or a scFv antibody comprising within the 20 C-terminal amino acid residues the amino acid sequence LPX1TG (SEQ ID NO: 01), (ii) a one-armed antibody comprising a full length antibody heavy chain, a full length antibody light chain, and an Fc-heavy chain, whereby the full length antibody heavy chain and the full length antibody light chain are cognate antibody chains that thereof forms an antigen binding site, whereby the full length antibody heavy chain and the Fc-heavy chain are covalently linked to each other via one or more disulfide bonds forming an antibody hinge region, and whereby the Fc-heavy chain has an oligoglycine amino acid sequence at its N-terminus, and (iii) a Sortase A enzyme.

Abstract: Herein is reported a method for producing a polypeptide in a prokaryotic cell, comprising the step of cultivating a prokaryotic cell comprising one or more nucleic acids encoding the polypeptide in a chemically defined minimal growth medium and recovering the polypeptide from the prokaryotic cell or the periplasm of the prokaryotic cell or from the medium, wherein the prokaryotic cell is an amino acid auxotrophy cured prokaryotic cell, wherein growth of the amino acid auxotrophy cured prokaryotic cell compared to the non-cured prokaryotic cell under the same cultivation conditions and in the same growth medium requires the supplementation of fewer amino acids to the growth medium, and wherein the chemically defined minimal growth medium is free of the amino acid corresponding to the auxotrophy that has been cured in the auxotrophy cured prokaryotic cell.