Patents by Inventor Frederic Duconge

Frederic Duconge has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Publication number: 20220073921
    Abstract: The present invention relates to an aptamer comprising a nucleotide sequence SEQ ID NO: 1 or a fragment thereof of at least 20 contiguous nucleotides of the nucleotide sequence SEQ ID NO: 2, wherein the aptamer comprises a polyethylene glycol (PEG) moiety conjugated to the 5? or the 3? end. The invention further relates to a composition comprising the aptamer, and the use of the aptamer in the diagnosis and treatment of cancer, particularly hormone refractory prostate tumours.
    Type: Application
    Filed: January 20, 2020
    Publication date: March 10, 2022
    Applicant: RHEINISCHE FRIEDRICH-WILHELMS-UNIVERSITÄT BONN
    Inventors: Frédéric DUCONGÉ, Andreas LINGNAU, Holger WEBER, Michael KUBBUTAT, Günter MAYER
  • Patent number: 9839700
    Abstract: The invention relates to polymerized micelles of size inferior to 100 nm for in vivo diagnosis, in particular of cancer. The polymerized micelles of the invention comprise a diagnostic agent and an amphiphilic polymer obtainable by the polymerization of an amphiphilic monomer, said monomer comprising: a lipophilic chain comprising a polymerizable vinylic or diacetylenic group, and a hydrophilic head comprising a polyoxyethylene or polyoxypropylene chain. The invention finds application in the pharmaceutical field, in particular.
    Type: Grant
    Filed: July 7, 2011
    Date of Patent: December 12, 2017
    Assignee: COMMISSARIAT A L'ENERGIE ATOMIQUE ET AUX ENERGIES ALTERNATIVES
    Inventors: Eric Doris, Frédéric Duconge, Edmond Gravel, Nicolas Mackiewicz, Bertrand Tavitian
  • Patent number: 9365854
    Abstract: The present invention relates to an aptamer comprising a nucleic acid comprising, or consisting of: —the sequence ACUGU CCCAG UAUGA CGCGA CUGCU UAGGU GGGAU GUUUC CCAUG CCUCG (SEQ ID NO: 1), or —a sequence comprising, or consisting of, at least 25 consecutive nucleotides in a sequence having at least 80% identity with SEQ ID NO: 1, with the proviso that a nucleic acid consisting of this sequence binds to the LAR protein.
    Type: Grant
    Filed: December 15, 2011
    Date of Patent: June 14, 2016
    Assignee: Commissariat a l'Energie Atomique et aux Energies alternatives
    Inventors: Frederic Duconge, Agnes Cibiel
  • Patent number: 8940886
    Abstract: The present invention relates to an aptamer which includes a nucleic acid including or made up of: the sequence GGAACGCAAGAACUGAGGCCAUGAGGCGCCUUCCCUUGCUCA GGACGC (SEQ ID NO: 1), or the sequence AGCUAGGCCGCAAGGUGCCUCAACGCCAUCUGAGUGCCGACC CGAUCGC (SEQ ID NO: 2), or a sequence including or made up of at least 25 consecutive nucleotides of a sequence that is at least 80% identical to SEQ ID NO: 1 or to SEQ ID NO: 2, with the condition that a nucleic acid made up of said sequence is bonded to annexin 2.
    Type: Grant
    Filed: November 10, 2011
    Date of Patent: January 27, 2015
    Assignee: Commissariat a l'Energie Atomique et aux Energies Alternatives
    Inventors: Frédéric Duconge, Agnès Cibiel
  • Publication number: 20130266515
    Abstract: The present invention relates to an aptamer which includes a nucleic acid including or made up of: the sequence GGAACGCAAGAACUGAGGCCAUGAGGCGCCUUCCCUUGCUCA GGACGC (SEQ ID NO: 1), or the sequence AGCUAGGCCGCAAGGUGCCUCAACGCCAUCUGAGUGCCGACC CGAUCGC (SEQ ID NO: 2), or a sequence including or made up of at least 25 consecutive nucleotides of a sequence that is at least 80% identical to SEQ ID NO: 1 or to SEQ ID NO: 2, with the condition that a nucleic acid made up of said sequence is bonded to annexin 2.
    Type: Application
    Filed: November 10, 2011
    Publication date: October 10, 2013
    Applicant: Commissariat A L'Energie Atomique ET AUX Energies Alternatives
    Inventors: Frédéric Duconge, Agnès Cibiel
  • Publication number: 20130266516
    Abstract: The present invention relates to an aptamer comprising a nucleic acid comprising, or consisting of: the sequence ACUGU CCCAG UAUGA CGCGA CUGCU UAGGU GGGAU GUUUC CCAUG CCUCG (SEQ ID NO: 1), or a sequence comprising, or consisting of, at least 25 consecutive nucleotides in a sequence having at least 80% identity with SEQ ID NO: 1, with the proviso that a nucleic acid consisting of this sequence binds to the LAR protein.
    Type: Application
    Filed: December 15, 2011
    Publication date: October 10, 2013
    Applicant: COMMISSARIAT A L'ENERGIE ATOMIQUE ET AUX ENERGIES
    Inventors: Frederic Duconge, Agnes Cibiel
  • Publication number: 20130230467
    Abstract: The invention relates to polymerized micelles of size inferior to 100 nm for in vivo diagnosis, in particular of cancer. The polymerized micelles of the invention comprise a diagnostic agent and an amphiphilic polymer obtainable by the polymerization of an amphiphilic monomer, said monomer comprising: a lipophilic chain comprising a polymerizable vinylic or diacetylenic group, and a hydrophilic head comprising a polyoxyethylene or polyoxypropylene chain. The invention finds application in the pharmaceutical field, in particular.
    Type: Application
    Filed: July 7, 2011
    Publication date: September 5, 2013
    Applicant: COMMISSARIAT A L'ENERGIE ATOMIQUE ET AUX ENERGIES ALTERNATIVES
    Inventors: Eric Doris, Frédéric Duconge, Edmond Gravel, Nicolas MacKiewicz, Bertrand Tavitian
  • Publication number: 20120041056
    Abstract: A nucleic acid includes at least 15 nucleotides with a length specifically binding with the human factor VII/VIIa.
    Type: Application
    Filed: February 19, 2010
    Publication date: February 16, 2012
    Applicant: LFB BIOTECHNOLOGIES
    Inventors: Gerald Perret, Frederic Duconge
  • Publication number: 20080227735
    Abstract: The invention relates to aptamers selected from live tumor cells and to the use thereof for diagnosis and treatment of certain cancers and other pathologies.
    Type: Application
    Filed: March 17, 2005
    Publication date: September 18, 2008
    Applicant: COMMISSARIAT A L'ENERGIE ATOMIQUE
    Inventors: Bertrand Tavitian, Frederic Duconge, Domenico Libri, Vittorio De Franciscis, Laura Cerchia